Incidental Mutation 'R8308:Krt27'
ID641203
Institutional Source Beutler Lab
Gene Symbol Krt27
Ensembl Gene ENSMUSG00000017588
Gene Namekeratin 27
SynonymsmIRSa3.1, Krt1-c29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location99345565-99351104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99349036 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 234 (E234G)
Ref Sequence ENSEMBL: ENSMUSP00000017732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017732]
Predicted Effect probably benign
Transcript: ENSMUST00000017732
AA Change: E234G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017732
Gene: ENSMUSG00000017588
AA Change: E234G

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
Filament 73 388 6.3e-151 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The mouse type I keratin genes are clustered in a region of chromosome 11. The encoded protein is involved in the formation of intermediate filaments in the inner root sheath. [provided by RefSeq, Sep 2015]
PHENOTYPE: Newborn heterozygotes show a slight bending of the whiskers. At ~P12, the coat develops a loose wave pattern. Whiskers of homozygotes are more curly and irregular while coat waviness occurs earlier and is more prominent. Adult coats are not waved but remains rough in texture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Krt27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Krt27 APN 11 99348721 missense probably damaging 0.98
R1957:Krt27 UTSW 11 99346483 critical splice donor site probably null
R2014:Krt27 UTSW 11 99349492 missense probably benign 0.09
R4095:Krt27 UTSW 11 99345793 missense probably benign 0.00
R4768:Krt27 UTSW 11 99349525 missense probably damaging 1.00
R4975:Krt27 UTSW 11 99346896 nonsense probably null
R5236:Krt27 UTSW 11 99350815 missense possibly damaging 0.87
R6750:Krt27 UTSW 11 99348980 missense probably damaging 0.96
R7044:Krt27 UTSW 11 99346814 missense probably benign 0.35
R7658:Krt27 UTSW 11 99349486 missense possibly damaging 0.69
R8937:Krt27 UTSW 11 99348725 missense probably damaging 1.00
Z1176:Krt27 UTSW 11 99348978 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCGTCTGAAATCTGCTGCTG -3'
(R):5'- ACATCAAGACCGTTTTAATTTCCCC -3'

Sequencing Primer
(F):5'- AGGCAGGAGCTGGTGTC -3'
(R):5'- ACAAGCCCAGGGTAGTAGCTC -3'
Posted On2020-07-28