Incidental Mutation 'R8308:Scara5'
ID641211
Institutional Source Beutler Lab
Gene Symbol Scara5
Ensembl Gene ENSMUSG00000022032
Gene Namescavenger receptor class A, member 5
Synonyms4932433F15Rik, 4933425F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65666403-65764826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 65689785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 44 (R44W)
Ref Sequence ENSEMBL: ENSMUSP00000022610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022610] [ENSMUST00000069226]
Predicted Effect probably damaging
Transcript: ENSMUST00000022610
AA Change: R44W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022610
Gene: ENSMUSG00000022032
AA Change: R44W

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 357 1.8e-8 PFAM
Pfam:Collagen 327 383 1.1e-8 PFAM
SR 389 489 5.5e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069226
AA Change: R44W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063391
Gene: ENSMUSG00000022032
AA Change: R44W

DomainStartEndE-ValueType
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Collagen 304 360 1e-11 PFAM
Pfam:Collagen 329 386 1.9e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous deletion of this gene results in decreased male fertility and lymphocytic infiltration of the stroma of various tissues, particularly in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Scara5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Scara5 APN 14 65738415 splice site probably benign
IGL00772:Scara5 APN 14 65670562 utr 5 prime probably benign
IGL01768:Scara5 APN 14 65689775 nonsense probably null
IGL02081:Scara5 APN 14 65730655 missense possibly damaging 0.96
IGL02280:Scara5 APN 14 65730778 missense probably benign
IGL02795:Scara5 APN 14 65730680 missense possibly damaging 0.72
IGL02887:Scara5 APN 14 65762829 missense unknown
R0040:Scara5 UTSW 14 65762717 splice site probably benign
R0605:Scara5 UTSW 14 65759648 missense possibly damaging 0.85
R0735:Scara5 UTSW 14 65731019 missense possibly damaging 0.85
R0925:Scara5 UTSW 14 65762718 critical splice acceptor site probably benign
R1575:Scara5 UTSW 14 65730865 missense probably benign 0.18
R1746:Scara5 UTSW 14 65731090 missense probably benign
R1968:Scara5 UTSW 14 65689800 missense possibly damaging 0.73
R4455:Scara5 UTSW 14 65762747 missense probably benign 0.01
R4547:Scara5 UTSW 14 65670574 missense possibly damaging 0.72
R4779:Scara5 UTSW 14 65730749 missense probably benign 0.03
R5218:Scara5 UTSW 14 65759662 frame shift probably null
R5316:Scara5 UTSW 14 65689815 missense possibly damaging 0.73
R5331:Scara5 UTSW 14 65759662 frame shift probably null
R5332:Scara5 UTSW 14 65759662 frame shift probably null
R5366:Scara5 UTSW 14 65759662 frame shift probably null
R5367:Scara5 UTSW 14 65759662 frame shift probably null
R5368:Scara5 UTSW 14 65759662 frame shift probably null
R5369:Scara5 UTSW 14 65759662 frame shift probably null
R5417:Scara5 UTSW 14 65759662 frame shift probably null
R5418:Scara5 UTSW 14 65759662 frame shift probably null
R5420:Scara5 UTSW 14 65759662 frame shift probably null
R5447:Scara5 UTSW 14 65759662 frame shift probably null
R5473:Scara5 UTSW 14 65740339 missense possibly damaging 0.84
R5580:Scara5 UTSW 14 65731079 missense probably benign 0.02
R7734:Scara5 UTSW 14 65731151 missense possibly damaging 0.85
R7995:Scara5 UTSW 14 65759608 missense possibly damaging 0.53
R8090:Scara5 UTSW 14 65742137 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAACAGCATGTGATGGCCC -3'
(R):5'- TGGTTTCCATAGCAACAAGGAC -3'

Sequencing Primer
(F):5'- CATGTGATGGCCCTAGAAAGTTCC -3'
(R):5'- CCTTTGGGCTTATGACAGTGAGAG -3'
Posted On2020-07-28