Incidental Mutation 'R8308:Uchl3'
ID641212
Institutional Source Beutler Lab
Gene Symbol Uchl3
Ensembl Gene ENSMUSG00000022111
Gene Nameubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location101653967-101696125 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 101695219 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002289]
Predicted Effect probably null
Transcript: ENSMUST00000002289
SMART Domains Protein: ENSMUSP00000002289
Gene: ENSMUSG00000022111

DomainStartEndE-ValueType
Pfam:Peptidase_C12 6 214 1.2e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the deubiquitinating enzyme family. Members of this family are proteases that catalyze the removal of ubiquitin from polypeptides and are divided into five classes, depending on the mechanism of catalysis. This protein may hydrolyze the ubiquitinyl-N-epsilon amide bond of ubiquitinated proteins to regenerate ubiquitin for another catalytic cycle. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null animals show degeneration in dorsal root ganglia. Mice display postnatal progressive retinal degeneration and muscular degeneration. In combination with a knockout of ubiquitin C-terminal hydrolase L1, neurological effects of each are accelerated, mice are dysphagic and die younger. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Uchl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0507:Uchl3 UTSW 14 101667007 nonsense probably null
R0992:Uchl3 UTSW 14 101668533 missense probably benign 0.08
R1365:Uchl3 UTSW 14 101654092 missense probably damaging 1.00
R2213:Uchl3 UTSW 14 101666670 critical splice donor site probably null
R2875:Uchl3 UTSW 14 101668560 missense probably benign 0.02
R5027:Uchl3 UTSW 14 101666546 missense possibly damaging 0.93
R5186:Uchl3 UTSW 14 101695917 missense probably damaging 1.00
R6737:Uchl3 UTSW 14 101690597 missense probably damaging 0.99
R7039:Uchl3 UTSW 14 101685692 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTGGAGTTGCTTTAAATGCAAATGG -3'
(R):5'- CGAGCTTATTCACACAGGGC -3'

Sequencing Primer
(F):5'- TGAATATTTGGGAGAAACTAAAGCC -3'
(R):5'- TATTCACACAGGGCTTGGGGAC -3'
Posted On2020-07-28