Incidental Mutation 'R8308:Gcsam'
ID641216
Institutional Source Beutler Lab
Gene Symbol Gcsam
Ensembl Gene ENSMUSG00000022659
Gene Namegerminal center associated, signaling and motility
SynonymsM17, Gcet2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location45610380-45622867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45610539 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 3 (N3I)
Ref Sequence ENSEMBL: ENSMUSP00000123853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023339] [ENSMUST00000159945] [ENSMUST00000161347]
Predicted Effect probably damaging
Transcript: ENSMUST00000023339
AA Change: N3I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000159945
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161347
AA Change: N3I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which may function in signal transduction pathways and whose expression is elevated in germinal cell lymphomas. It contains a putative PDZ-interacting domain, an immunoreceptor tyrosine-based activation motif (ITAM), and two putative SH2 binding sites. In B cells, its expression is specifically induced by interleukin-4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a decreased number of and smaller Peyer's patches. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Gcsam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Gcsam APN 16 45615952 missense probably damaging 0.99
IGL02136:Gcsam APN 16 45610533 start codon destroyed probably null 1.00
IGL02986:Gcsam APN 16 45620003 missense probably benign 0.09
IGL03116:Gcsam APN 16 45620068 missense possibly damaging 0.56
Germ UTSW 16 45616938 critical splice donor site probably null
R1441:Gcsam UTSW 16 45613038 missense probably benign 0.06
R1716:Gcsam UTSW 16 45619993 missense probably damaging 1.00
R1981:Gcsam UTSW 16 45619974 missense probably damaging 1.00
R3976:Gcsam UTSW 16 45619829 missense probably damaging 0.96
R5584:Gcsam UTSW 16 45619863 missense probably benign 0.25
R7414:Gcsam UTSW 16 45616938 critical splice donor site probably null
R7417:Gcsam UTSW 16 45619877 missense probably damaging 1.00
R7918:Gcsam UTSW 16 45620139 makesense probably null
R8369:Gcsam UTSW 16 45616006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGCCCTGGTCTTTCAAG -3'
(R):5'- AACCTGTAAGGATAGTCACATGG -3'

Sequencing Primer
(F):5'- TTCCTCCACCATCCAGCAGG -3'
(R):5'- AAGGATAGTCACATGGTGTATGGCTC -3'
Posted On2020-07-28