Incidental Mutation 'R8308:Olfr194'
ID641217
Institutional Source Beutler Lab
Gene Symbol Olfr194
Ensembl Gene ENSMUSG00000063020
Gene Nameolfactory receptor 194
SynonymsMOR182-13, MOR182-7P, GA_x54KRFPKG5P-55348161-55347241
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59116537-59121069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59119536 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 178 (C178Y)
Ref Sequence ENSEMBL: ENSMUSP00000072407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072608]
Predicted Effect probably damaging
Transcript: ENSMUST00000072608
AA Change: C178Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072407
Gene: ENSMUSG00000063020
AA Change: C178Y

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.7e-47 PFAM
Pfam:7tm_1 40 289 1.9e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Olfr194
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Olfr194 APN 16 59119573 missense possibly damaging 0.94
IGL02098:Olfr194 APN 16 59120070 utr 5 prime probably benign
IGL02276:Olfr194 APN 16 59120015 missense probably benign 0.01
IGL03122:Olfr194 APN 16 59119438 missense probably benign 0.00
R0781:Olfr194 UTSW 16 59119824 missense probably damaging 0.97
R1162:Olfr194 UTSW 16 59119372 missense probably damaging 0.99
R1526:Olfr194 UTSW 16 59119930 missense probably damaging 1.00
R1654:Olfr194 UTSW 16 59119689 missense possibly damaging 0.50
R4379:Olfr194 UTSW 16 59119664 missense probably benign 0.22
R4380:Olfr194 UTSW 16 59119664 missense probably benign 0.22
R5768:Olfr194 UTSW 16 59119972 small deletion probably benign
R5771:Olfr194 UTSW 16 59119972 small deletion probably benign
R5942:Olfr194 UTSW 16 59119676 nonsense probably null
R6131:Olfr194 UTSW 16 59119893 missense probably damaging 1.00
R6539:Olfr194 UTSW 16 59119751 missense probably damaging 0.99
R6621:Olfr194 UTSW 16 59119924 missense probably benign 0.19
R7642:Olfr194 UTSW 16 59119648 missense possibly damaging 0.94
R8863:Olfr194 UTSW 16 59119349 nonsense probably null
RF009:Olfr194 UTSW 16 59119911 missense probably damaging 0.99
Z1177:Olfr194 UTSW 16 59119372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGGTGGAGAAGGCTTTTC -3'
(R):5'- TGCAACTACAGAATGTTTCCTTCTG -3'

Sequencing Primer
(F):5'- CTTCTGCCCCTCTCAGACTTTG -3'
(R):5'- ATGGCCTATGACCGCTATGTAGC -3'
Posted On2020-07-28