Incidental Mutation 'R8308:Vmn2r104'
ID641218
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Namevomeronasal 2, receptor 104
SynonymsV2r7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location20029425-20048205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20040778 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 461 (D461G)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168050
AA Change: D461G

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: D461G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20048002 nonsense probably null
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20048193 missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20030081 missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030110 missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20041709 missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20042726 missense probably benign
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20030221 missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20030203 missense possibly damaging 0.89
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAGTATACTAATGTTGCCTTATG -3'
(R):5'- GAATACTCCGGTTTTCACTTAGTCATC -3'

Sequencing Primer
(F):5'- ACAACTGTTGACCCTGAG -3'
(R):5'- CGGTTTTCACTTAGTCATCAATAATG -3'
Posted On2020-07-28