Incidental Mutation 'R8308:Abca17'
ID 641219
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 067793-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8308 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24267683 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1457 (T1457A)
Ref Sequence ENSEMBL: ENSMUSP00000046218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably damaging
Transcript: ENSMUST00000039324
AA Change: T1457A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: T1457A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121226
AA Change: T1457A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: T1457A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24,295,191 (GRCm38) missense probably benign 0.14
IGL00585:Abca17 APN 17 24,300,320 (GRCm38) missense probably damaging 0.99
IGL00941:Abca17 APN 17 24,317,130 (GRCm38) missense probably damaging 1.00
IGL01987:Abca17 APN 17 24,346,228 (GRCm38) missense probably benign 0.00
IGL01988:Abca17 APN 17 24,334,255 (GRCm38) missense probably damaging 0.99
IGL02223:Abca17 APN 17 24,287,935 (GRCm38) nonsense probably null
IGL02368:Abca17 APN 17 24,287,793 (GRCm38) missense probably benign 0.01
IGL02405:Abca17 APN 17 24,279,062 (GRCm38) missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24,298,984 (GRCm38) missense probably benign 0.05
IGL02607:Abca17 APN 17 24,327,705 (GRCm38) nonsense probably null
IGL02706:Abca17 APN 17 24,298,992 (GRCm38) missense probably benign 0.00
IGL02729:Abca17 APN 17 24,280,481 (GRCm38) missense probably benign 0.06
IGL02818:Abca17 APN 17 24,300,352 (GRCm38) missense probably benign 0.02
IGL02891:Abca17 APN 17 24,281,366 (GRCm38) missense probably damaging 0.99
IGL03236:Abca17 APN 17 24,326,476 (GRCm38) splice site probably benign
IGL03299:Abca17 APN 17 24,265,591 (GRCm38) missense probably damaging 1.00
basin UTSW 17 24,318,185 (GRCm38) missense probably benign 0.01
Bowl UTSW 17 24,317,238 (GRCm38) missense probably benign 0.09
R0018:Abca17 UTSW 17 24,313,188 (GRCm38) splice site probably null
R0467:Abca17 UTSW 17 24,313,177 (GRCm38) splice site probably benign
R0671:Abca17 UTSW 17 24,281,249 (GRCm38) missense probably benign 0.00
R1175:Abca17 UTSW 17 24,289,351 (GRCm38) missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24,285,759 (GRCm38) missense probably benign 0.18
R1398:Abca17 UTSW 17 24,328,537 (GRCm38) missense probably damaging 0.96
R1678:Abca17 UTSW 17 24,335,620 (GRCm38) missense probably benign 0.05
R1696:Abca17 UTSW 17 24,267,658 (GRCm38) missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24,267,557 (GRCm38) missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24,267,716 (GRCm38) missense probably damaging 1.00
R1970:Abca17 UTSW 17 24,307,575 (GRCm38) missense probably benign 0.00
R1997:Abca17 UTSW 17 24,285,726 (GRCm38) missense probably benign 0.02
R2141:Abca17 UTSW 17 24,334,266 (GRCm38) missense probably benign 0.00
R2199:Abca17 UTSW 17 24,335,624 (GRCm38) missense probably benign 0.19
R2394:Abca17 UTSW 17 24,281,216 (GRCm38) splice site probably null
R2442:Abca17 UTSW 17 24,328,632 (GRCm38) missense probably benign 0.02
R2509:Abca17 UTSW 17 24,289,613 (GRCm38) splice site probably benign
R2848:Abca17 UTSW 17 24,289,507 (GRCm38) missense probably damaging 0.96
R2849:Abca17 UTSW 17 24,289,507 (GRCm38) missense probably damaging 0.96
R2859:Abca17 UTSW 17 24,281,314 (GRCm38) missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24,289,507 (GRCm38) missense probably damaging 0.96
R2935:Abca17 UTSW 17 24,289,507 (GRCm38) missense probably damaging 0.96
R3153:Abca17 UTSW 17 24,328,746 (GRCm38) missense probably damaging 1.00
R3154:Abca17 UTSW 17 24,328,746 (GRCm38) missense probably damaging 1.00
R3434:Abca17 UTSW 17 24,289,537 (GRCm38) missense probably damaging 1.00
R3695:Abca17 UTSW 17 24,289,507 (GRCm38) missense probably damaging 0.96
R3905:Abca17 UTSW 17 24,296,283 (GRCm38) missense probably benign 0.13
R4282:Abca17 UTSW 17 24,299,060 (GRCm38) missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24,318,268 (GRCm38) missense probably damaging 1.00
R4350:Abca17 UTSW 17 24,279,046 (GRCm38) critical splice donor site probably null
R4548:Abca17 UTSW 17 24,334,271 (GRCm38) missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24,321,084 (GRCm38) missense probably damaging 1.00
R4722:Abca17 UTSW 17 24,265,429 (GRCm38) missense probably damaging 1.00
R4745:Abca17 UTSW 17 24,307,453 (GRCm38) missense probably damaging 1.00
R4818:Abca17 UTSW 17 24,317,161 (GRCm38) missense probably damaging 0.98
R5279:Abca17 UTSW 17 24,289,414 (GRCm38) missense probably damaging 1.00
R5310:Abca17 UTSW 17 24,281,230 (GRCm38) missense probably benign 0.00
R5320:Abca17 UTSW 17 24,307,567 (GRCm38) missense probably damaging 1.00
R5435:Abca17 UTSW 17 24,267,614 (GRCm38) missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24,327,668 (GRCm38) missense probably benign 0.14
R5776:Abca17 UTSW 17 24,295,158 (GRCm38) missense probably benign 0.09
R5928:Abca17 UTSW 17 24,318,185 (GRCm38) missense probably benign 0.01
R6013:Abca17 UTSW 17 24,287,846 (GRCm38) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,281,245 (GRCm38) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,281,245 (GRCm38) missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24,318,191 (GRCm38) missense probably benign 0.00
R6063:Abca17 UTSW 17 24,264,344 (GRCm38) missense unknown
R6404:Abca17 UTSW 17 24,265,918 (GRCm38) missense probably benign 0.13
R6746:Abca17 UTSW 17 24,346,221 (GRCm38) nonsense probably null
R6819:Abca17 UTSW 17 24,287,793 (GRCm38) missense probably benign 0.01
R6828:Abca17 UTSW 17 24,326,415 (GRCm38) missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24,265,500 (GRCm38) missense probably damaging 1.00
R7065:Abca17 UTSW 17 24,327,751 (GRCm38) missense probably damaging 1.00
R7123:Abca17 UTSW 17 24,265,975 (GRCm38) missense probably damaging 1.00
R7157:Abca17 UTSW 17 24,335,590 (GRCm38) missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24,335,626 (GRCm38) missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24,321,009 (GRCm38) missense not run
R7352:Abca17 UTSW 17 24,289,054 (GRCm38) nonsense probably null
R7355:Abca17 UTSW 17 24,267,647 (GRCm38) missense probably benign 0.00
R7358:Abca17 UTSW 17 24,291,555 (GRCm38) missense probably benign 0.00
R7411:Abca17 UTSW 17 24,328,569 (GRCm38) missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24,265,533 (GRCm38) missense probably damaging 1.00
R8039:Abca17 UTSW 17 24,328,725 (GRCm38) missense probably damaging 1.00
R8095:Abca17 UTSW 17 24,317,222 (GRCm38) missense possibly damaging 0.77
R8517:Abca17 UTSW 17 24,317,233 (GRCm38) missense probably benign 0.00
R8811:Abca17 UTSW 17 24,317,238 (GRCm38) missense probably benign 0.09
R8819:Abca17 UTSW 17 24,328,602 (GRCm38) missense probably damaging 1.00
R8820:Abca17 UTSW 17 24,328,602 (GRCm38) missense probably damaging 1.00
R8953:Abca17 UTSW 17 24,299,041 (GRCm38) missense probably benign
R9095:Abca17 UTSW 17 24,281,396 (GRCm38) missense probably damaging 0.97
R9313:Abca17 UTSW 17 24,346,233 (GRCm38) missense probably benign 0.00
R9314:Abca17 UTSW 17 24,328,619 (GRCm38) missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24,264,505 (GRCm38) missense probably benign
R9351:Abca17 UTSW 17 24,291,777 (GRCm38) missense probably benign 0.00
R9387:Abca17 UTSW 17 24,334,281 (GRCm38) missense probably benign 0.02
R9388:Abca17 UTSW 17 24,264,299 (GRCm38) missense unknown
R9440:Abca17 UTSW 17 24,280,478 (GRCm38) missense probably benign 0.02
R9498:Abca17 UTSW 17 24,265,506 (GRCm38) missense probably damaging 1.00
R9654:Abca17 UTSW 17 24,317,125 (GRCm38) missense probably benign 0.09
R9709:Abca17 UTSW 17 24,298,960 (GRCm38) missense probably benign
R9770:Abca17 UTSW 17 24,295,147 (GRCm38) missense probably benign 0.00
R9773:Abca17 UTSW 17 24,289,591 (GRCm38) missense probably damaging 1.00
RF024:Abca17 UTSW 17 24,287,732 (GRCm38) frame shift probably null
RF029:Abca17 UTSW 17 24,287,727 (GRCm38) critical splice donor site probably benign
RF032:Abca17 UTSW 17 24,287,727 (GRCm38) frame shift probably null
RF036:Abca17 UTSW 17 24,287,727 (GRCm38) critical splice donor site probably benign
X0017:Abca17 UTSW 17 24,317,163 (GRCm38) missense probably benign 0.26
X0065:Abca17 UTSW 17 24,334,284 (GRCm38) missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24,279,107 (GRCm38) missense probably benign 0.03
Z1088:Abca17 UTSW 17 24,279,079 (GRCm38) missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24,346,219 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTTGCAAATGGAGGTGGG -3'
(R):5'- ATGGCTCCTTCATGCTGCATG -3'

Sequencing Primer
(F):5'- TGCAAATGGAGGTGGGAAGGATAAG -3'
(R):5'- CTGCATGAGTGTCCCTATAGTAGAC -3'
Posted On 2020-07-28