Incidental Mutation 'R8308:Crem'
ID641220
Institutional Source Beutler Lab
Gene Symbol Crem
Ensembl Gene ENSMUSG00000063889
Gene NamecAMP responsive element modulator
SynonymsICER
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location3266048-3337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3295397 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 57 (T57K)
Ref Sequence ENSEMBL: ENSMUSP00000121118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025069] [ENSMUST00000082141] [ENSMUST00000122958] [ENSMUST00000123672] [ENSMUST00000126578] [ENSMUST00000129435] [ENSMUST00000130455] [ENSMUST00000130599] [ENSMUST00000131899] [ENSMUST00000134027] [ENSMUST00000136961] [ENSMUST00000137568] [ENSMUST00000142690] [ENSMUST00000144496] [ENSMUST00000146265] [ENSMUST00000148305] [ENSMUST00000149803] [ENSMUST00000150235] [ENSMUST00000151311] [ENSMUST00000152108] [ENSMUST00000152900] [ENSMUST00000154135] [ENSMUST00000154470] [ENSMUST00000154715] [ENSMUST00000156234] [ENSMUST00000165086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025069
AA Change: T110K

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025069
Gene: ENSMUSG00000063889
AA Change: T110K

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 3.1e-20 PFAM
BRLZ 285 343 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082141
AA Change: T61K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080780
Gene: ENSMUSG00000063889
AA Change: T61K

DomainStartEndE-ValueType
Pfam:pKID 63 104 2.6e-20 PFAM
BRLZ 248 306 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122958
AA Change: T57K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121118
Gene: ENSMUSG00000063889
AA Change: T57K

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 301 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123672
AA Change: T45K

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120557
Gene: ENSMUSG00000063889
AA Change: T45K

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.5e-20 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126578
AA Change: T57K

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114780
Gene: ENSMUSG00000063889
AA Change: T57K

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 302 3.8e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118649
Gene: ENSMUSG00000063889
AA Change: T95K

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:pKID 98 139 3.1e-21 PFAM
BRLZ 271 328 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129435
AA Change: T8K

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117438
Gene: ENSMUSG00000063889
AA Change: T8K

DomainStartEndE-ValueType
Pfam:pKID 10 51 5.6e-21 PFAM
BRLZ 183 240 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130455
AA Change: T100K

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121541
Gene: ENSMUSG00000063889
AA Change: T100K

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.8e-20 PFAM
BRLZ 275 333 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130599
AA Change: T45K

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115471
Gene: ENSMUSG00000063889
AA Change: T45K

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.6e-20 PFAM
BRLZ 169 226 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131899
AA Change: T100K

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119353
Gene: ENSMUSG00000063889
AA Change: T100K

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.2e-20 PFAM
BRLZ 224 282 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134027
Predicted Effect possibly damaging
Transcript: ENSMUST00000136961
AA Change: T33K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115363
Gene: ENSMUSG00000063889
AA Change: T33K

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.5e-21 PFAM
BRLZ 208 265 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137568
AA Change: T51K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115336
Gene: ENSMUSG00000063889
AA Change: T51K

DomainStartEndE-ValueType
Pfam:pKID 53 94 1.5e-20 PFAM
BRLZ 163 221 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142690
AA Change: T94K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122282
Gene: ENSMUSG00000063889
AA Change: T94K

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 138 4.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144496
AA Change: T33K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120349
Gene: ENSMUSG00000063889
AA Change: T33K

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.9e-21 PFAM
BRLZ 220 277 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146265
AA Change: T100K

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119638
Gene: ENSMUSG00000063889
AA Change: T100K

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.1e-20 PFAM
BRLZ 212 269 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148305
Predicted Effect probably damaging
Transcript: ENSMUST00000149803
AA Change: T45K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121210
Gene: ENSMUSG00000063889
AA Change: T45K

DomainStartEndE-ValueType
Pfam:pKID 47 89 2.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150235
AA Change: T110K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121233
Gene: ENSMUSG00000063889
AA Change: T110K

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 1.1e-20 PFAM
BRLZ 297 354 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000151311
AA Change: T61K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118267
Gene: ENSMUSG00000063889
AA Change: T61K

DomainStartEndE-ValueType
Pfam:pKID 63 104 7.5e-21 PFAM
BRLZ 236 293 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152108
AA Change: T33K

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122241
Gene: ENSMUSG00000063889
AA Change: T33K

DomainStartEndE-ValueType
Pfam:pKID 35 76 4.7e-21 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152900
AA Change: T51K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123515
Gene: ENSMUSG00000063889
AA Change: T51K

DomainStartEndE-ValueType
Pfam:pKID 53 94 2.4e-20 PFAM
BRLZ 238 296 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154135
AA Change: T61K

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122051
Gene: ENSMUSG00000063889
AA Change: T61K

DomainStartEndE-ValueType
Pfam:pKID 63 104 1.9e-20 PFAM
BRLZ 185 243 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154470
AA Change: T110K

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118128
Gene: ENSMUSG00000063889
AA Change: T110K

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.3e-20 PFAM
BRLZ 222 280 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154715
AA Change: T82K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122179
Gene: ENSMUSG00000063889
AA Change: T82K

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
Pfam:pKID 84 125 8.7e-21 PFAM
BRLZ 269 327 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156234
AA Change: T94K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121388
Gene: ENSMUSG00000063889
AA Change: T94K

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 137 9.1e-21 PFAM
BRLZ 281 339 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165086
AA Change: T110K

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127353
Gene: ENSMUSG00000063889
AA Change: T110K

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.4e-20 PFAM
BRLZ 234 292 3.8e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygotes for targeted mutations exhibit reduced regenerative capacity after partial hepatectomy and reduced cardiac function. Males are sterile due to a block in spermiogenesis associated with a lack of postmeiotic gene expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Crem
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Crem APN 18 3299236 missense probably damaging 1.00
IGL01532:Crem APN 18 3276732 missense probably benign 0.02
IGL02500:Crem APN 18 3273477 missense probably damaging 1.00
IGL03280:Crem APN 18 3273415 splice site probably benign
menthe UTSW 18 3268070 missense probably damaging 1.00
R0379:Crem UTSW 18 3299226 missense probably damaging 1.00
R0987:Crem UTSW 18 3288060 missense probably damaging 0.98
R1829:Crem UTSW 18 3295037 splice site probably null
R1932:Crem UTSW 18 3299284 missense probably benign 0.27
R2086:Crem UTSW 18 3288098 intron probably benign
R2093:Crem UTSW 18 3299256 missense probably damaging 1.00
R4152:Crem UTSW 18 3288055 missense probably damaging 0.99
R4568:Crem UTSW 18 3299175 missense probably damaging 0.98
R4758:Crem UTSW 18 3327527 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6445:Crem UTSW 18 3309671 missense probably benign
R6525:Crem UTSW 18 3268070 missense probably damaging 1.00
R6651:Crem UTSW 18 3325428 missense probably benign 0.18
R7035:Crem UTSW 18 3327503 missense probably damaging 1.00
R7137:Crem UTSW 18 3273459 missense possibly damaging 0.89
R7401:Crem UTSW 18 3295329 missense probably damaging 1.00
R7463:Crem UTSW 18 3295094 missense probably benign 0.06
R7516:Crem UTSW 18 3299141 splice site probably null
R8095:Crem UTSW 18 3295106 missense probably benign 0.00
R8146:Crem UTSW 18 3288007 missense possibly damaging 0.68
R8266:Crem UTSW 18 3309535 intron probably benign
R8825:Crem UTSW 18 3268061 missense probably damaging 0.99
R8899:Crem UTSW 18 3295370 missense probably damaging 0.99
Z1176:Crem UTSW 18 3267730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAATACCAGGCACATCAG -3'
(R):5'- CCTGTGAAGTCCTACTTGGTATTC -3'

Sequencing Primer
(F):5'- GCACATCAGAGGAAAGTTCATTC -3'
(R):5'- CTCTCCACATAAGCACTG -3'
Posted On2020-07-28