Incidental Mutation 'R8309:Rp1'
ID641223
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Nameretinitis pigmentosa 1 (human)
SynonymsDcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R8309 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location3999557-4409241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4347089 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1267 (V1267L)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
Predicted Effect probably benign
Transcript: ENSMUST00000027032
AA Change: V1267L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: V1267L

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T A 2: 35,389,587 Y34F possibly damaging Het
Abcb6 A T 1: 75,172,944 S664T probably benign Het
Abcc4 C T 14: 118,616,392 V443M probably damaging Het
Abhd2 G A 7: 79,348,347 G209D probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Apbb2 T A 5: 66,362,836 M449L probably benign Het
Ccdc81 T A 7: 89,877,578 probably null Het
Cd209b A T 8: 3,926,559 C42* probably null Het
Cirh1a A T 8: 106,916,221 T504S probably benign Het
Clec18a A T 8: 111,082,057 M11K probably benign Het
Clock A T 5: 76,254,422 S130R probably benign Het
Col12a1 G A 9: 79,605,183 A2910V possibly damaging Het
Col6a4 C T 9: 106,075,215 A495T probably benign Het
Cyp4f37 A T 17: 32,634,978 N467I probably damaging Het
Ddo G A 10: 40,637,379 V106M possibly damaging Het
Dennd5a A G 7: 109,901,125 L931P probably damaging Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Dnah7b T C 1: 46,139,872 S902P probably damaging Het
Dnal4 T G 15: 79,762,510 I57L probably benign Het
Dst T A 1: 34,117,511 I174N probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efhb T C 17: 53,449,535 T363A probably damaging Het
Ehbp1l1 A G 19: 5,717,075 F1245S probably damaging Het
Eif4g1 A G 16: 20,688,828 D1453G probably benign Het
Fam102b G A 3: 109,027,342 probably benign Het
Fbp1 T C 13: 62,869,017 I224V probably benign Het
Gm10782 T G 13: 56,363,135 F79V noncoding transcript Het
Gm281 G A 14: 13,814,954 Q860* probably null Het
Gm498 A G 7: 143,883,943 N126S possibly damaging Het
Gpaa1 C G 15: 76,331,960 R47G possibly damaging Het
Hs2st1 G A 3: 144,437,604 S226L possibly damaging Het
Hydin A G 8: 110,607,902 Y4992C probably benign Het
Ikbke A T 1: 131,263,328 C549* probably null Het
Insrr G A 3: 87,810,442 G817S probably benign Het
Itgb5 G A 16: 33,865,553 V88I probably benign Het
Krt78 A G 15: 101,946,487 V963A probably benign Het
Lars T C 18: 42,243,028 Y239C possibly damaging Het
Map2k5 A G 9: 63,339,079 probably null Het
Mfn2 A T 4: 147,890,236 W118R probably benign Het
Mga T A 2: 119,960,930 I2550N probably damaging Het
Mgam A G 6: 40,745,177 I401V possibly damaging Het
Mrps18c A G 5: 100,804,398 Y141C probably damaging Het
Myo1e A T 9: 70,346,763 I565L possibly damaging Het
Nfatc4 G A 14: 55,826,391 E112K probably damaging Het
Nubp1 A G 16: 10,421,622 M255V probably benign Het
Olfr622 A G 7: 103,639,451 S230P probably damaging Het
Olfr702 A C 7: 106,824,413 S38A probably benign Het
Olfr952 C T 9: 39,426,670 V134I probably benign Het
Pask A T 1: 93,312,851 C1264* probably null Het
Pcgf2 T C 11: 97,691,743 T173A probably benign Het
Plcg1 T C 2: 160,753,933 I574T probably benign Het
Plin4 T C 17: 56,104,437 T865A probably damaging Het
Pnpt1 T C 11: 29,153,277 V514A probably benign Het
Ppp1r3a T A 6: 14,719,701 I405F probably benign Het
Qpctl A G 7: 19,148,473 V86A probably benign Het
Rab3gap1 G T 1: 127,909,918 W239L possibly damaging Het
Ralgapa2 T A 2: 146,404,866 T939S possibly damaging Het
Rapgef2 G T 3: 79,083,202 T923N possibly damaging Het
Rit2 T A 18: 31,153,845 I96F probably damaging Het
Rnase13 A T 14: 51,922,436 I82N probably damaging Het
Serpinb9b G A 13: 33,039,571 E249K probably damaging Het
Serpinb9c G T 13: 33,150,111 T344K possibly damaging Het
Serpinh1 T C 7: 99,348,944 I160V possibly damaging Het
Sipa1 A G 19: 5,654,936 S544P probably damaging Het
Slc17a5 A T 9: 78,571,029 Y231* probably null Het
Srcap T C 7: 127,549,357 V1959A probably damaging Het
Srrm4 G A 5: 116,591,567 probably benign Het
Stat1 T C 1: 52,151,245 I553T possibly damaging Het
Stpg1 A G 4: 135,529,592 I231M probably benign Het
Szt2 G GC 4: 118,375,482 probably null Het
Trpv3 C T 11: 73,279,921 T209M probably damaging Het
Tsc22d2 G T 3: 58,417,123 G479C unknown Het
Ttc3 A G 16: 94,466,979 H1950R probably damaging Het
Tusc3 A G 8: 39,164,841 *348W probably null Het
Vmn1r15 A G 6: 57,258,650 M168V probably benign Het
Wdr34 A G 2: 30,032,189 L420P probably damaging Het
Wdr60 T C 12: 116,256,085 E79G probably damaging Het
Xrcc5 T A 1: 72,319,127 M207K possibly damaging Het
Zdbf2 T A 1: 63,306,591 N1376K possibly damaging Het
Zfp558 A C 9: 18,456,917 S192A probably benign Het
Zfp964 A G 8: 69,663,274 T175A possibly damaging Het
Zfp988 A G 4: 147,332,308 R400G probably damaging Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAGATCATCAGTGCATTTGTTTTC -3'
(R):5'- GCATCCAGCCTTCATAGTGTG -3'

Sequencing Primer
(F):5'- GCATTTGTTTTCTTTTGAATGCACAG -3'
(R):5'- CAGCCTTCATAGTGTGGACGAG -3'
Posted On2020-07-28