Mutagenetix > Incidental Mutation

Incidental Mutation 'R8309:Zdbf2'

641227

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

067794-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R8309 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63306591 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1376 (N1376K)

Ref Sequence

ENSEMBL: ENSMUSP00000029025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: N1376K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: N1376K

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: N1376K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: N1376K

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Meta Mutation Damage Score

0.0670

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	A	2: 35,389,587	Y34F	possibly damaging	Het
Abcb6	A	T	1: 75,172,944	S664T	probably benign	Het
Abcc4	C	T	14: 118,616,392	V443M	probably damaging	Het
Abhd2	G	A	7: 79,348,347	G209D	probably damaging	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Apbb2	T	A	5: 66,362,836	M449L	probably benign	Het
Ccdc81	T	A	7: 89,877,578		probably null	Het
Cd209b	A	T	8: 3,926,559	C42*	probably null	Het
Clec18a	A	T	8: 111,082,057	M11K	probably benign	Het
Clock	A	T	5: 76,254,422	S130R	probably benign	Het
Col12a1	G	A	9: 79,605,183	A2910V	possibly damaging	Het
Col6a4	C	T	9: 106,075,215	A495T	probably benign	Het
Cyp4f37	A	T	17: 32,634,978	N467I	probably damaging	Het
Ddo	G	A	10: 40,637,379	V106M	possibly damaging	Het
Dennd5a	A	G	7: 109,901,125	L931P	probably damaging	Het
Dgcr6	A	G	16: 18,066,734	D82G	probably damaging	Het
Dnah7b	T	C	1: 46,139,872	S902P	probably damaging	Het
Dnal4	T	G	15: 79,762,510	I57L	probably benign	Het
Dst	T	A	1: 34,117,511	I174N	probably damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Efhb	T	C	17: 53,449,535	T363A	probably damaging	Het
Ehbp1l1	A	G	19: 5,717,075	F1245S	probably damaging	Het
Eif4g1	A	G	16: 20,688,828	D1453G	probably benign	Het
Fam102b	G	A	3: 109,027,342		probably benign	Het
Fbp1	T	C	13: 62,869,017	I224V	probably benign	Het
Gm10782	T	G	13: 56,363,135	F79V	noncoding transcript	Het
Gm281	G	A	14: 13,814,954	Q860*	probably null	Het
Gm498	A	G	7: 143,883,943	N126S	possibly damaging	Het
Gpaa1	C	G	15: 76,331,960	R47G	possibly damaging	Het
Hs2st1	G	A	3: 144,437,604	S226L	possibly damaging	Het
Hydin	A	G	8: 110,607,902	Y4992C	probably benign	Het
Ikbke	A	T	1: 131,263,328	C549*	probably null	Het
Insrr	G	A	3: 87,810,442	G817S	probably benign	Het
Itgb5	G	A	16: 33,865,553	V88I	probably benign	Het
Krt78	A	G	15: 101,946,487	V963A	probably benign	Het
Lars	T	C	18: 42,243,028	Y239C	possibly damaging	Het
Map2k5	A	G	9: 63,339,079		probably null	Het
Mfn2	A	T	4: 147,890,236	W118R	probably benign	Het
Mga	T	A	2: 119,960,930	I2550N	probably damaging	Het
Mgam	A	G	6: 40,745,177	I401V	possibly damaging	Het
Mrps18c	A	G	5: 100,804,398	Y141C	probably damaging	Het
Myo1e	A	T	9: 70,346,763	I565L	possibly damaging	Het
Nfatc4	G	A	14: 55,826,391	E112K	probably damaging	Het
Nubp1	A	G	16: 10,421,622	M255V	probably benign	Het
Olfr622	A	G	7: 103,639,451	S230P	probably damaging	Het
Olfr702	A	C	7: 106,824,413	S38A	probably benign	Het
Olfr952	C	T	9: 39,426,670	V134I	probably benign	Het
Pask	A	T	1: 93,312,851	C1264*	probably null	Het
Pcgf2	T	C	11: 97,691,743	T173A	probably benign	Het
Plcg1	T	C	2: 160,753,933	I574T	probably benign	Het
Plin4	T	C	17: 56,104,437	T865A	probably damaging	Het
Pnpt1	T	C	11: 29,153,277	V514A	probably benign	Het
Ppp1r3a	T	A	6: 14,719,701	I405F	probably benign	Het
Qpctl	A	G	7: 19,148,473	V86A	probably benign	Het
Rab3gap1	G	T	1: 127,909,918	W239L	possibly damaging	Het
Ralgapa2	T	A	2: 146,404,866	T939S	possibly damaging	Het
Rapgef2	G	T	3: 79,083,202	T923N	possibly damaging	Het
Rit2	T	A	18: 31,153,845	I96F	probably damaging	Het
Rnase13	A	T	14: 51,922,436	I82N	probably damaging	Het
Rp1	C	A	1: 4,347,089	V1267L	probably benign	Het
Serpinb9b	G	A	13: 33,039,571	E249K	probably damaging	Het
Serpinb9c	G	T	13: 33,150,111	T344K	possibly damaging	Het
Serpinh1	T	C	7: 99,348,944	I160V	possibly damaging	Het
Sipa1	A	G	19: 5,654,936	S544P	probably damaging	Het
Slc17a5	A	T	9: 78,571,029	Y231*	probably null	Het
Srcap	T	C	7: 127,549,357	V1959A	probably damaging	Het
Srrm4	G	A	5: 116,591,567		probably benign	Het
Stat1	T	C	1: 52,151,245	I553T	possibly damaging	Het
Stpg1	A	G	4: 135,529,592	I231M	probably benign	Het
Szt2	G	GC	4: 118,375,482		probably null	Het
Trpv3	C	T	11: 73,279,921	T209M	probably damaging	Het
Tsc22d2	G	T	3: 58,417,123	G479C	unknown	Het
Ttc3	A	G	16: 94,466,979	H1950R	probably damaging	Het
Tusc3	A	G	8: 39,164,841	*348W	probably null	Het
Utp4	A	T	8: 106,916,221	T504S	probably benign	Het
Vmn1r15	A	G	6: 57,258,650	M168V	probably benign	Het
Wdr34	A	G	2: 30,032,189	L420P	probably damaging	Het
Wdr60	T	C	12: 116,256,085	E79G	probably damaging	Het
Wdsub1	C	T	2: 59,874,234		probably benign	Het
Xrcc5	T	A	1: 72,319,127	M207K	possibly damaging	Het
Zc3h7a	A	T	16: 11,146,553		probably benign	Het
Zfp558	A	C	9: 18,456,917	S192A	probably benign	Het
Zfp964	A	G	8: 69,663,274	T175A	possibly damaging	Het
Zfp988	A	G	4: 147,332,308	R400G	probably damaging	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1720:Zdbf2	UTSW	1	63303277	missense	possibly damaging	0.46
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CGCAACACAAGAGCCTGTTG -3'
(R):5'- ATGGAACTGTCACAAACTGAAC -3'

Sequencing Primer
(F):5'- GCCTGTTGAAGAAATAAATTTACCG -3'
(R):5'- TGTCACAAACTGAACAGGATCGTC -3'

Posted On

2020-07-28