Incidental Mutation 'R8309:Zdbf2'
ID 641227
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 067794-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8309 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63345750 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1376 (N1376K)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: N1376K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: N1376K

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: N1376K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: N1376K

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T A 2: 35,279,599 (GRCm39) Y34F possibly damaging Het
Abcb6 A T 1: 75,149,588 (GRCm39) S664T probably benign Het
Abcc4 C T 14: 118,853,804 (GRCm39) V443M probably damaging Het
Abhd2 G A 7: 78,998,095 (GRCm39) G209D probably damaging Het
Acte1 A G 7: 143,437,680 (GRCm39) N126S possibly damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Apbb2 T A 5: 66,520,179 (GRCm39) M449L probably benign Het
Ccdc81 T A 7: 89,526,786 (GRCm39) probably null Het
Cd209b A T 8: 3,976,559 (GRCm39) C42* probably null Het
Cdhr18 G A 14: 13,814,954 (GRCm38) Q860* probably null Het
Clec18a A T 8: 111,808,689 (GRCm39) M11K probably benign Het
Clock A T 5: 76,402,269 (GRCm39) S130R probably benign Het
Col12a1 G A 9: 79,512,465 (GRCm39) A2910V possibly damaging Het
Col6a4 C T 9: 105,952,414 (GRCm39) A495T probably benign Het
Cyp4f37 A T 17: 32,853,952 (GRCm39) N467I probably damaging Het
Ddo G A 10: 40,513,375 (GRCm39) V106M possibly damaging Het
Dennd5a A G 7: 109,500,332 (GRCm39) L931P probably damaging Het
Dgcr6 A G 16: 17,884,598 (GRCm39) D82G probably damaging Het
Dnah7b T C 1: 46,179,032 (GRCm39) S902P probably damaging Het
Dnal4 T G 15: 79,646,711 (GRCm39) I57L probably benign Het
Dst T A 1: 34,156,592 (GRCm39) I174N probably damaging Het
Dync2i1 T C 12: 116,219,705 (GRCm39) E79G probably damaging Het
Dync2i2 A G 2: 29,922,201 (GRCm39) L420P probably damaging Het
Eeig2 G A 3: 108,934,658 (GRCm39) probably benign Het
Efhb T C 17: 53,756,563 (GRCm39) T363A probably damaging Het
Ehbp1l1 A G 19: 5,767,103 (GRCm39) F1245S probably damaging Het
Eif4g1 A G 16: 20,507,578 (GRCm39) D1453G probably benign Het
Fbp1 T C 13: 63,016,831 (GRCm39) I224V probably benign Het
Gm10782 T G 13: 56,510,948 (GRCm39) F79V noncoding transcript Het
Gpaa1 C G 15: 76,216,160 (GRCm39) R47G possibly damaging Het
Hs2st1 G A 3: 144,143,365 (GRCm39) S226L possibly damaging Het
Hydin A G 8: 111,334,534 (GRCm39) Y4992C probably benign Het
Ikbke A T 1: 131,191,065 (GRCm39) C549* probably null Het
Insrr G A 3: 87,717,749 (GRCm39) G817S probably benign Het
Itgb5 G A 16: 33,685,923 (GRCm39) V88I probably benign Het
Krt78 A G 15: 101,854,922 (GRCm39) V963A probably benign Het
Lars1 T C 18: 42,376,093 (GRCm39) Y239C possibly damaging Het
Map2k5 A G 9: 63,246,361 (GRCm39) probably null Het
Mfn2 A T 4: 147,974,693 (GRCm39) W118R probably benign Het
Mga T A 2: 119,791,411 (GRCm39) I2550N probably damaging Het
Mgam A G 6: 40,722,111 (GRCm39) I401V possibly damaging Het
Mrps18c A G 5: 100,952,264 (GRCm39) Y141C probably damaging Het
Myo1e A T 9: 70,254,045 (GRCm39) I565L possibly damaging Het
Nfatc4 G A 14: 56,063,848 (GRCm39) E112K probably damaging Het
Nubp1 A G 16: 10,239,486 (GRCm39) M255V probably benign Het
Or13n4 A C 7: 106,423,620 (GRCm39) S38A probably benign Het
Or52a33 A G 7: 103,288,658 (GRCm39) S230P probably damaging Het
Or8g33 C T 9: 39,337,966 (GRCm39) V134I probably benign Het
Pask A T 1: 93,240,573 (GRCm39) C1264* probably null Het
Pcgf2 T C 11: 97,582,569 (GRCm39) T173A probably benign Het
Plcg1 T C 2: 160,595,853 (GRCm39) I574T probably benign Het
Plin4 T C 17: 56,411,437 (GRCm39) T865A probably damaging Het
Pnpt1 T C 11: 29,103,277 (GRCm39) V514A probably benign Het
Ppp1r3a T A 6: 14,719,700 (GRCm39) I405F probably benign Het
Qpctl A G 7: 18,882,398 (GRCm39) V86A probably benign Het
Rab3gap1 G T 1: 127,837,655 (GRCm39) W239L possibly damaging Het
Ralgapa2 T A 2: 146,246,786 (GRCm39) T939S possibly damaging Het
Rapgef2 G T 3: 78,990,509 (GRCm39) T923N possibly damaging Het
Rit2 T A 18: 31,286,898 (GRCm39) I96F probably damaging Het
Rnase13 A T 14: 52,159,893 (GRCm39) I82N probably damaging Het
Rp1 C A 1: 4,417,312 (GRCm39) V1267L probably benign Het
Serpinb9b G A 13: 33,223,554 (GRCm39) E249K probably damaging Het
Serpinb9c G T 13: 33,334,094 (GRCm39) T344K possibly damaging Het
Serpinh1 T C 7: 98,998,151 (GRCm39) I160V possibly damaging Het
Sipa1 A G 19: 5,704,964 (GRCm39) S544P probably damaging Het
Slc17a5 A T 9: 78,478,311 (GRCm39) Y231* probably null Het
Srcap T C 7: 127,148,529 (GRCm39) V1959A probably damaging Het
Srrm4 G A 5: 116,729,626 (GRCm39) probably benign Het
Stat1 T C 1: 52,190,404 (GRCm39) I553T possibly damaging Het
Stpg1 A G 4: 135,256,903 (GRCm39) I231M probably benign Het
Szt2 G GC 4: 118,232,679 (GRCm39) probably null Het
Trpv3 C T 11: 73,170,747 (GRCm39) T209M probably damaging Het
Tsc22d2 G T 3: 58,324,544 (GRCm39) G479C unknown Het
Ttc3 A G 16: 94,267,838 (GRCm39) H1950R probably damaging Het
Tusc3 A G 8: 39,617,882 (GRCm39) *348W probably null Het
Utp4 A T 8: 107,642,853 (GRCm39) T504S probably benign Het
Vmn1r15 A G 6: 57,235,635 (GRCm39) M168V probably benign Het
Wdsub1 C T 2: 59,704,578 (GRCm39) probably benign Het
Xrcc5 T A 1: 72,358,286 (GRCm39) M207K possibly damaging Het
Zc3h7a A T 16: 10,964,417 (GRCm39) probably benign Het
Zfp558 A C 9: 18,368,213 (GRCm39) S192A probably benign Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Zfp964 A G 8: 70,115,924 (GRCm39) T175A possibly damaging Het
Zfp988 A G 4: 147,416,765 (GRCm39) R400G probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGCAACACAAGAGCCTGTTG -3'
(R):5'- ATGGAACTGTCACAAACTGAAC -3'

Sequencing Primer
(F):5'- GCCTGTTGAAGAAATAAATTTACCG -3'
(R):5'- TGTCACAAACTGAACAGGATCGTC -3'
Posted On 2020-07-28