Mutagenetix > Incidental Mutation

Incidental Mutation 'R8309:Szt2'

641244

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

067794-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.593) question?

Stock #

R8309 (G1)

Quality Score

197.468

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

G to GC at 118375482 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000075406

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183402

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402F06Rik	T	A	2: 35,389,587	Y34F	possibly damaging	Het
Abcb6	A	T	1: 75,172,944	S664T	probably benign	Het
Abcc4	C	T	14: 118,616,392	V443M	probably damaging	Het
Abhd2	G	A	7: 79,348,347	G209D	probably damaging	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Apbb2	T	A	5: 66,362,836	M449L	probably benign	Het
Ccdc81	T	A	7: 89,877,578		probably null	Het
Cd209b	A	T	8: 3,926,559	C42*	probably null	Het
Clec18a	A	T	8: 111,082,057	M11K	probably benign	Het
Clock	A	T	5: 76,254,422	S130R	probably benign	Het
Col12a1	G	A	9: 79,605,183	A2910V	possibly damaging	Het
Col6a4	C	T	9: 106,075,215	A495T	probably benign	Het
Cyp4f37	A	T	17: 32,634,978	N467I	probably damaging	Het
Ddo	G	A	10: 40,637,379	V106M	possibly damaging	Het
Dennd5a	A	G	7: 109,901,125	L931P	probably damaging	Het
Dgcr6	A	G	16: 18,066,734	D82G	probably damaging	Het
Dnah7b	T	C	1: 46,139,872	S902P	probably damaging	Het
Dnal4	T	G	15: 79,762,510	I57L	probably benign	Het
Dst	T	A	1: 34,117,511	I174N	probably damaging	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Efhb	T	C	17: 53,449,535	T363A	probably damaging	Het
Ehbp1l1	A	G	19: 5,717,075	F1245S	probably damaging	Het
Eif4g1	A	G	16: 20,688,828	D1453G	probably benign	Het
Fam102b	G	A	3: 109,027,342		probably benign	Het
Fbp1	T	C	13: 62,869,017	I224V	probably benign	Het
Gm10782	T	G	13: 56,363,135	F79V	noncoding transcript	Het
Gm281	G	A	14: 13,814,954	Q860*	probably null	Het
Gm498	A	G	7: 143,883,943	N126S	possibly damaging	Het
Gpaa1	C	G	15: 76,331,960	R47G	possibly damaging	Het
Hs2st1	G	A	3: 144,437,604	S226L	possibly damaging	Het
Hydin	A	G	8: 110,607,902	Y4992C	probably benign	Het
Ikbke	A	T	1: 131,263,328	C549*	probably null	Het
Insrr	G	A	3: 87,810,442	G817S	probably benign	Het
Itgb5	G	A	16: 33,865,553	V88I	probably benign	Het
Krt78	A	G	15: 101,946,487	V963A	probably benign	Het
Lars	T	C	18: 42,243,028	Y239C	possibly damaging	Het
Map2k5	A	G	9: 63,339,079		probably null	Het
Mfn2	A	T	4: 147,890,236	W118R	probably benign	Het
Mga	T	A	2: 119,960,930	I2550N	probably damaging	Het
Mgam	A	G	6: 40,745,177	I401V	possibly damaging	Het
Mrps18c	A	G	5: 100,804,398	Y141C	probably damaging	Het
Myo1e	A	T	9: 70,346,763	I565L	possibly damaging	Het
Nfatc4	G	A	14: 55,826,391	E112K	probably damaging	Het
Nubp1	A	G	16: 10,421,622	M255V	probably benign	Het
Olfr622	A	G	7: 103,639,451	S230P	probably damaging	Het
Olfr702	A	C	7: 106,824,413	S38A	probably benign	Het
Olfr952	C	T	9: 39,426,670	V134I	probably benign	Het
Pask	A	T	1: 93,312,851	C1264*	probably null	Het
Pcgf2	T	C	11: 97,691,743	T173A	probably benign	Het
Plcg1	T	C	2: 160,753,933	I574T	probably benign	Het
Plin4	T	C	17: 56,104,437	T865A	probably damaging	Het
Pnpt1	T	C	11: 29,153,277	V514A	probably benign	Het
Ppp1r3a	T	A	6: 14,719,701	I405F	probably benign	Het
Qpctl	A	G	7: 19,148,473	V86A	probably benign	Het
Rab3gap1	G	T	1: 127,909,918	W239L	possibly damaging	Het
Ralgapa2	T	A	2: 146,404,866	T939S	possibly damaging	Het
Rapgef2	G	T	3: 79,083,202	T923N	possibly damaging	Het
Rit2	T	A	18: 31,153,845	I96F	probably damaging	Het
Rnase13	A	T	14: 51,922,436	I82N	probably damaging	Het
Rp1	C	A	1: 4,347,089	V1267L	probably benign	Het
Serpinb9b	G	A	13: 33,039,571	E249K	probably damaging	Het
Serpinb9c	G	T	13: 33,150,111	T344K	possibly damaging	Het
Serpinh1	T	C	7: 99,348,944	I160V	possibly damaging	Het
Sipa1	A	G	19: 5,654,936	S544P	probably damaging	Het
Slc17a5	A	T	9: 78,571,029	Y231*	probably null	Het
Srcap	T	C	7: 127,549,357	V1959A	probably damaging	Het
Srrm4	G	A	5: 116,591,567		probably benign	Het
Stat1	T	C	1: 52,151,245	I553T	possibly damaging	Het
Stpg1	A	G	4: 135,529,592	I231M	probably benign	Het
Trpv3	C	T	11: 73,279,921	T209M	probably damaging	Het
Tsc22d2	G	T	3: 58,417,123	G479C	unknown	Het
Ttc3	A	G	16: 94,466,979	H1950R	probably damaging	Het
Tusc3	A	G	8: 39,164,841	*348W	probably null	Het
Utp4	A	T	8: 106,916,221	T504S	probably benign	Het
Vmn1r15	A	G	6: 57,258,650	M168V	probably benign	Het
Wdr34	A	G	2: 30,032,189	L420P	probably damaging	Het
Wdr60	T	C	12: 116,256,085	E79G	probably damaging	Het
Wdsub1	C	T	2: 59,874,234		probably benign	Het
Xrcc5	T	A	1: 72,319,127	M207K	possibly damaging	Het
Zc3h7a	A	T	16: 11,146,553		probably benign	Het
Zdbf2	T	A	1: 63,306,591	N1376K	possibly damaging	Het
Zfp558	A	C	9: 18,456,917	S192A	probably benign	Het
Zfp964	A	G	8: 69,663,274	T175A	possibly damaging	Het
Zfp988	A	G	4: 147,332,308	R400G	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACATGTTTGCGAGATGAGTTC -3'
(R):5'- ACAGGTGACCTCCACTTTCC -3'

Sequencing Primer
(F):5'- AGATGAGTTCTAAGGCTAGCCCC -3'
(R):5'- TCCCCTCCAGCTCAGGATG -3'

Posted On

2020-07-28