Incidental Mutation 'R8309:Map2k5'
ID641273
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8309 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 63339079 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000034920
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T A 2: 35,389,587 Y34F possibly damaging Het
Abcb6 A T 1: 75,172,944 S664T probably benign Het
Abcc4 C T 14: 118,616,392 V443M probably damaging Het
Abhd2 G A 7: 79,348,347 G209D probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Apbb2 T A 5: 66,362,836 M449L probably benign Het
Ccdc81 T A 7: 89,877,578 probably null Het
Cd209b A T 8: 3,926,559 C42* probably null Het
Cirh1a A T 8: 106,916,221 T504S probably benign Het
Clec18a A T 8: 111,082,057 M11K probably benign Het
Clock A T 5: 76,254,422 S130R probably benign Het
Col12a1 G A 9: 79,605,183 A2910V possibly damaging Het
Col6a4 C T 9: 106,075,215 A495T probably benign Het
Cyp4f37 A T 17: 32,634,978 N467I probably damaging Het
Ddo G A 10: 40,637,379 V106M possibly damaging Het
Dennd5a A G 7: 109,901,125 L931P probably damaging Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Dnah7b T C 1: 46,139,872 S902P probably damaging Het
Dnal4 T G 15: 79,762,510 I57L probably benign Het
Dst T A 1: 34,117,511 I174N probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efhb T C 17: 53,449,535 T363A probably damaging Het
Ehbp1l1 A G 19: 5,717,075 F1245S probably damaging Het
Eif4g1 A G 16: 20,688,828 D1453G probably benign Het
Fam102b G A 3: 109,027,342 probably benign Het
Fbp1 T C 13: 62,869,017 I224V probably benign Het
Gm10782 T G 13: 56,363,135 F79V noncoding transcript Het
Gm281 G A 14: 13,814,954 Q860* probably null Het
Gm498 A G 7: 143,883,943 N126S possibly damaging Het
Gpaa1 C G 15: 76,331,960 R47G possibly damaging Het
Hs2st1 G A 3: 144,437,604 S226L possibly damaging Het
Hydin A G 8: 110,607,902 Y4992C probably benign Het
Ikbke A T 1: 131,263,328 C549* probably null Het
Insrr G A 3: 87,810,442 G817S probably benign Het
Itgb5 G A 16: 33,865,553 V88I probably benign Het
Krt78 A G 15: 101,946,487 V963A probably benign Het
Lars T C 18: 42,243,028 Y239C possibly damaging Het
Mfn2 A T 4: 147,890,236 W118R probably benign Het
Mga T A 2: 119,960,930 I2550N probably damaging Het
Mgam A G 6: 40,745,177 I401V possibly damaging Het
Mrps18c A G 5: 100,804,398 Y141C probably damaging Het
Myo1e A T 9: 70,346,763 I565L possibly damaging Het
Nfatc4 G A 14: 55,826,391 E112K probably damaging Het
Nubp1 A G 16: 10,421,622 M255V probably benign Het
Olfr622 A G 7: 103,639,451 S230P probably damaging Het
Olfr702 A C 7: 106,824,413 S38A probably benign Het
Olfr952 C T 9: 39,426,670 V134I probably benign Het
Pask A T 1: 93,312,851 C1264* probably null Het
Pcgf2 T C 11: 97,691,743 T173A probably benign Het
Plcg1 T C 2: 160,753,933 I574T probably benign Het
Plin4 T C 17: 56,104,437 T865A probably damaging Het
Pnpt1 T C 11: 29,153,277 V514A probably benign Het
Ppp1r3a T A 6: 14,719,701 I405F probably benign Het
Qpctl A G 7: 19,148,473 V86A probably benign Het
Rab3gap1 G T 1: 127,909,918 W239L possibly damaging Het
Ralgapa2 T A 2: 146,404,866 T939S possibly damaging Het
Rapgef2 G T 3: 79,083,202 T923N possibly damaging Het
Rit2 T A 18: 31,153,845 I96F probably damaging Het
Rnase13 A T 14: 51,922,436 I82N probably damaging Het
Rp1 C A 1: 4,347,089 V1267L probably benign Het
Serpinb9b G A 13: 33,039,571 E249K probably damaging Het
Serpinb9c G T 13: 33,150,111 T344K possibly damaging Het
Serpinh1 T C 7: 99,348,944 I160V possibly damaging Het
Sipa1 A G 19: 5,654,936 S544P probably damaging Het
Slc17a5 A T 9: 78,571,029 Y231* probably null Het
Srcap T C 7: 127,549,357 V1959A probably damaging Het
Srrm4 G A 5: 116,591,567 probably benign Het
Stat1 T C 1: 52,151,245 I553T possibly damaging Het
Stpg1 A G 4: 135,529,592 I231M probably benign Het
Szt2 G GC 4: 118,375,482 probably null Het
Trpv3 C T 11: 73,279,921 T209M probably damaging Het
Tsc22d2 G T 3: 58,417,123 G479C unknown Het
Ttc3 A G 16: 94,466,979 H1950R probably damaging Het
Tusc3 A G 8: 39,164,841 *348W probably null Het
Vmn1r15 A G 6: 57,258,650 M168V probably benign Het
Wdr34 A G 2: 30,032,189 L420P probably damaging Het
Wdr60 T C 12: 116,256,085 E79G probably damaging Het
Wdsub1 C T 2: 59,874,234 probably benign Het
Xrcc5 T A 1: 72,319,127 M207K possibly damaging Het
Zc3h7a A T 16: 11,146,553 probably benign Het
Zdbf2 T A 1: 63,306,591 N1376K possibly damaging Het
Zfp558 A C 9: 18,456,917 S192A probably benign Het
Zfp964 A G 8: 69,663,274 T175A possibly damaging Het
Zfp988 A G 4: 147,332,308 R400G probably damaging Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8017:Map2k5 UTSW 9 63339121 missense probably damaging 0.98
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
R8247:Map2k5 UTSW 9 63371737 missense probably damaging 1.00
R8341:Map2k5 UTSW 9 63339098 missense probably damaging 1.00
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATACAGATGTGGCCCTTCC -3'
(R):5'- TTTATAAACACTCACTCCTGCACG -3'

Sequencing Primer
(F):5'- CACCTCCACCACTCGAAAATGG -3'
(R):5'- TGCACGTTAAAAACCCAGTTC -3'
Posted On2020-07-28