Incidental Mutation 'R8309:Trpv3'
ID641280
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8309 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73279921 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 209 (T209M)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
PDB Structure Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049676
AA Change: T209M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: T209M

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T A 2: 35,389,587 Y34F possibly damaging Het
Abcb6 A T 1: 75,172,944 S664T probably benign Het
Abcc4 C T 14: 118,616,392 V443M probably damaging Het
Abhd2 G A 7: 79,348,347 G209D probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Apbb2 T A 5: 66,362,836 M449L probably benign Het
Ccdc81 T A 7: 89,877,578 probably null Het
Cd209b A T 8: 3,926,559 C42* probably null Het
Cirh1a A T 8: 106,916,221 T504S probably benign Het
Clec18a A T 8: 111,082,057 M11K probably benign Het
Clock A T 5: 76,254,422 S130R probably benign Het
Col12a1 G A 9: 79,605,183 A2910V possibly damaging Het
Col6a4 C T 9: 106,075,215 A495T probably benign Het
Cyp4f37 A T 17: 32,634,978 N467I probably damaging Het
Ddo G A 10: 40,637,379 V106M possibly damaging Het
Dennd5a A G 7: 109,901,125 L931P probably damaging Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Dnah7b T C 1: 46,139,872 S902P probably damaging Het
Dnal4 T G 15: 79,762,510 I57L probably benign Het
Dst T A 1: 34,117,511 I174N probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efhb T C 17: 53,449,535 T363A probably damaging Het
Ehbp1l1 A G 19: 5,717,075 F1245S probably damaging Het
Eif4g1 A G 16: 20,688,828 D1453G probably benign Het
Fam102b G A 3: 109,027,342 probably benign Het
Fbp1 T C 13: 62,869,017 I224V probably benign Het
Gm10782 T G 13: 56,363,135 F79V noncoding transcript Het
Gm281 G A 14: 13,814,954 Q860* probably null Het
Gm498 A G 7: 143,883,943 N126S possibly damaging Het
Gpaa1 C G 15: 76,331,960 R47G possibly damaging Het
Hs2st1 G A 3: 144,437,604 S226L possibly damaging Het
Hydin A G 8: 110,607,902 Y4992C probably benign Het
Ikbke A T 1: 131,263,328 C549* probably null Het
Insrr G A 3: 87,810,442 G817S probably benign Het
Itgb5 G A 16: 33,865,553 V88I probably benign Het
Krt78 A G 15: 101,946,487 V963A probably benign Het
Lars T C 18: 42,243,028 Y239C possibly damaging Het
Map2k5 A G 9: 63,339,079 probably null Het
Mfn2 A T 4: 147,890,236 W118R probably benign Het
Mga T A 2: 119,960,930 I2550N probably damaging Het
Mgam A G 6: 40,745,177 I401V possibly damaging Het
Mrps18c A G 5: 100,804,398 Y141C probably damaging Het
Myo1e A T 9: 70,346,763 I565L possibly damaging Het
Nfatc4 G A 14: 55,826,391 E112K probably damaging Het
Nubp1 A G 16: 10,421,622 M255V probably benign Het
Olfr622 A G 7: 103,639,451 S230P probably damaging Het
Olfr702 A C 7: 106,824,413 S38A probably benign Het
Olfr952 C T 9: 39,426,670 V134I probably benign Het
Pask A T 1: 93,312,851 C1264* probably null Het
Pcgf2 T C 11: 97,691,743 T173A probably benign Het
Plcg1 T C 2: 160,753,933 I574T probably benign Het
Plin4 T C 17: 56,104,437 T865A probably damaging Het
Pnpt1 T C 11: 29,153,277 V514A probably benign Het
Ppp1r3a T A 6: 14,719,701 I405F probably benign Het
Qpctl A G 7: 19,148,473 V86A probably benign Het
Rab3gap1 G T 1: 127,909,918 W239L possibly damaging Het
Ralgapa2 T A 2: 146,404,866 T939S possibly damaging Het
Rapgef2 G T 3: 79,083,202 T923N possibly damaging Het
Rit2 T A 18: 31,153,845 I96F probably damaging Het
Rnase13 A T 14: 51,922,436 I82N probably damaging Het
Rp1 C A 1: 4,347,089 V1267L probably benign Het
Serpinb9b G A 13: 33,039,571 E249K probably damaging Het
Serpinb9c G T 13: 33,150,111 T344K possibly damaging Het
Serpinh1 T C 7: 99,348,944 I160V possibly damaging Het
Sipa1 A G 19: 5,654,936 S544P probably damaging Het
Slc17a5 A T 9: 78,571,029 Y231* probably null Het
Srcap T C 7: 127,549,357 V1959A probably damaging Het
Srrm4 G A 5: 116,591,567 probably benign Het
Stat1 T C 1: 52,151,245 I553T possibly damaging Het
Stpg1 A G 4: 135,529,592 I231M probably benign Het
Szt2 G GC 4: 118,375,482 probably null Het
Tsc22d2 G T 3: 58,417,123 G479C unknown Het
Ttc3 A G 16: 94,466,979 H1950R probably damaging Het
Tusc3 A G 8: 39,164,841 *348W probably null Het
Vmn1r15 A G 6: 57,258,650 M168V probably benign Het
Wdr34 A G 2: 30,032,189 L420P probably damaging Het
Wdr60 T C 12: 116,256,085 E79G probably damaging Het
Wdsub1 C T 2: 59,874,234 probably benign Het
Xrcc5 T A 1: 72,319,127 M207K possibly damaging Het
Zc3h7a A T 16: 11,146,553 probably benign Het
Zdbf2 T A 1: 63,306,591 N1376K possibly damaging Het
Zfp558 A C 9: 18,456,917 S192A probably benign Het
Zfp964 A G 8: 69,663,274 T175A possibly damaging Het
Zfp988 A G 4: 147,332,308 R400G probably damaging Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73278954 missense probably benign
R3916:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3917:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73287420 nonsense probably null
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6130:Trpv3 UTSW 11 73296483 missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73291693 missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73277992 missense probably benign
R7434:Trpv3 UTSW 11 73288261 missense probably damaging 0.96
R7440:Trpv3 UTSW 11 73277974 missense probably benign 0.37
R7741:Trpv3 UTSW 11 73288262 missense probably damaging 0.99
R7750:Trpv3 UTSW 11 73286021 missense probably damaging 0.99
R7785:Trpv3 UTSW 11 73277732 missense probably benign 0.43
R8354:Trpv3 UTSW 11 73291622 missense probably damaging 1.00
R8383:Trpv3 UTSW 11 73289301 missense probably benign 0.30
R8443:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R8454:Trpv3 UTSW 11 73291622 missense probably damaging 1.00
R8492:Trpv3 UTSW 11 73288209 nonsense probably null
R8556:Trpv3 UTSW 11 73287465 missense probably benign
R8701:Trpv3 UTSW 11 73278936 missense possibly damaging 0.84
R9046:Trpv3 UTSW 11 73285872 missense probably damaging 1.00
Z1186:Trpv3 UTSW 11 73269687 missense probably benign
Z1186:Trpv3 UTSW 11 73278977 missense probably benign
Z1186:Trpv3 UTSW 11 73283676 missense probably benign
Z1187:Trpv3 UTSW 11 73269687 missense probably benign
Z1187:Trpv3 UTSW 11 73278977 missense probably benign
Z1187:Trpv3 UTSW 11 73283676 missense probably benign
Z1188:Trpv3 UTSW 11 73269687 missense probably benign
Z1188:Trpv3 UTSW 11 73278977 missense probably benign
Z1188:Trpv3 UTSW 11 73283676 missense probably benign
Z1189:Trpv3 UTSW 11 73269687 missense probably benign
Z1189:Trpv3 UTSW 11 73278977 missense probably benign
Z1189:Trpv3 UTSW 11 73283676 missense probably benign
Z1190:Trpv3 UTSW 11 73269687 missense probably benign
Z1190:Trpv3 UTSW 11 73278977 missense probably benign
Z1190:Trpv3 UTSW 11 73283676 missense probably benign
Z1191:Trpv3 UTSW 11 73269687 missense probably benign
Z1191:Trpv3 UTSW 11 73278977 missense probably benign
Z1191:Trpv3 UTSW 11 73283676 missense probably benign
Z1192:Trpv3 UTSW 11 73269687 missense probably benign
Z1192:Trpv3 UTSW 11 73278977 missense probably benign
Z1192:Trpv3 UTSW 11 73283676 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGTCTGCAGACTTCCG -3'
(R):5'- CACGCTCAGCATTATTTACAGG -3'

Sequencing Primer
(F):5'- GCCTTTATCCTTGACTGTCTGTAGAC -3'
(R):5'- CGCTCAGCATTATTTACAGGGAAAAG -3'
Posted On2020-07-28