Incidental Mutation 'R0100:Fam81a'
ID64130
Institutional Source Beutler Lab
Gene Symbol Fam81a
Ensembl Gene ENSMUSG00000032224
Gene Namefamily with sequence similarity 81, member A
Synonyms
MMRRC Submission 038386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0100 (G1)
Quality Score152
Status Validated
Chromosome9
Chromosomal Location70088511-70142560 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 70102809 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034749]
Predicted Effect probably benign
Transcript: ENSMUST00000034749
SMART Domains Protein: ENSMUSP00000034749
Gene: ENSMUSG00000032224

DomainStartEndE-ValueType
coiled coil region 75 106 N/A INTRINSIC
coiled coil region 158 187 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145427
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,254,011 I442T possibly damaging Het
Agrn A G 4: 156,174,958 C814R probably damaging Het
Bbof1 T A 12: 84,411,055 D31E probably benign Het
Ccdc51 C T 9: 109,091,998 Q318* probably null Het
Cpxm2 T A 7: 132,054,871 H554L possibly damaging Het
Dbr1 T A 9: 99,583,669 D433E probably benign Het
Ddx55 C T 5: 124,556,782 T91I probably damaging Het
Dhx57 T C 17: 80,275,156 D340G possibly damaging Het
Dnah1 C T 14: 31,262,152 probably null Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Fat4 A C 3: 38,980,248 N2683T probably damaging Het
Fbxo47 C T 11: 97,868,606 G165S probably damaging Het
Gpatch2 C A 1: 187,225,817 A123E probably damaging Het
Greb1 T A 12: 16,680,224 Q1734L probably benign Het
Gtf2ird2 T C 5: 134,217,015 L705P probably damaging Het
H13 T A 2: 152,689,863 probably null Het
Hip1 T C 5: 135,436,453 D367G probably benign Het
Ift140 C T 17: 25,090,954 Q1112* probably null Het
Il17b A G 18: 61,690,271 M59V probably benign Het
Lpin3 T C 2: 160,905,340 Y829H probably damaging Het
Mocs3 C T 2: 168,231,190 R186C probably damaging Het
Olfr1105 T C 2: 87,033,595 T209A probably benign Het
Olfr121 T C 17: 37,752,703 F283S probably benign Het
Olfr1225 T A 2: 89,171,087 I42F probably benign Het
Olfr1344 C T 7: 6,440,400 R167C probably damaging Het
Osgepl1 A G 1: 53,323,213 I405V probably damaging Het
Pdcd11 T C 19: 47,102,666 S360P probably benign Het
Plekhs1 A G 19: 56,478,502 E255G probably damaging Het
Tex22 T A 12: 113,088,772 I150N probably benign Het
Tmem106a T C 11: 101,586,258 S98P probably benign Het
Tnfrsf18 A G 4: 156,028,366 T170A probably benign Het
Trpc6 C T 9: 8,653,034 P614S probably damaging Het
Usp28 C A 9: 49,035,932 P566Q probably damaging Het
Washc5 A G 15: 59,344,098 F811L possibly damaging Het
Other mutations in Fam81a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Fam81a APN 9 70099152 nonsense probably null
IGL02010:Fam81a APN 9 70099137 missense probably benign 0.04
IGL02891:Fam81a APN 9 70110276 missense probably damaging 1.00
R0497:Fam81a UTSW 9 70096119 missense possibly damaging 0.47
R0621:Fam81a UTSW 9 70093647 missense probably benign 0.35
R1075:Fam81a UTSW 9 70110274 nonsense probably null
R1524:Fam81a UTSW 9 70125108 missense probably damaging 1.00
R4970:Fam81a UTSW 9 70093590 nonsense probably null
R5138:Fam81a UTSW 9 70099175 missense probably benign 0.01
R5209:Fam81a UTSW 9 70125160 missense probably benign 0.06
R6139:Fam81a UTSW 9 70102818 critical splice donor site probably null
R6378:Fam81a UTSW 9 70110346 missense probably damaging 1.00
R7145:Fam81a UTSW 9 70110278 missense probably damaging 1.00
R8030:Fam81a UTSW 9 70102909 missense probably benign 0.11
R8350:Fam81a UTSW 9 70125018 missense probably damaging 1.00
R8450:Fam81a UTSW 9 70125018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAACTCTCTGTGGTCTGGCTTC -3'
(R):5'- TCGTATGCAAGGCAGCTCTTTCG -3'

Sequencing Primer
(F):5'- TCTGGCTTCCAGATTCGTG -3'
(R):5'- ATGCTTTTAAACTTTAATGGGTGTG -3'
Posted On2013-08-06