Incidental Mutation 'R8309:Ehbp1l1'
ID641305
Institutional Source Beutler Lab
Gene Symbol Ehbp1l1
Ensembl Gene ENSMUSG00000024937
Gene NameEH domain binding protein 1-like 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8309 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5707376-5726317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5717075 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1245 (F1245S)
Ref Sequence ENSEMBL: ENSMUSP00000037656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049295] [ENSMUST00000075606]
Predicted Effect probably damaging
Transcript: ENSMUST00000049295
AA Change: F1245S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037656
Gene: ENSMUSG00000024937
AA Change: F1245S

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.2e-24 PFAM
low complexity region 245 256 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
internal_repeat_1 442 821 1.71e-12 PROSPERO
internal_repeat_1 833 1197 1.71e-12 PROSPERO
CH 1212 1310 3.55e-16 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1426 1449 N/A INTRINSIC
low complexity region 1471 1484 N/A INTRINSIC
low complexity region 1493 1547 N/A INTRINSIC
DUF3585 1552 1696 6.7e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075606
AA Change: F301S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126740
Gene: ENSMUSG00000024937
AA Change: F301S

DomainStartEndE-ValueType
Pfam:NT-C2 12 164 3.9e-25 PFAM
CH 268 366 3.55e-16 SMART
low complexity region 372 387 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 603 N/A INTRINSIC
DUF3585 608 752 6.7e-59 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout leads to a reduction in the length and density of small intestinal microvilli, severe anemia, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T A 2: 35,389,587 Y34F possibly damaging Het
Abcb6 A T 1: 75,172,944 S664T probably benign Het
Abcc4 C T 14: 118,616,392 V443M probably damaging Het
Abhd2 G A 7: 79,348,347 G209D probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Apbb2 T A 5: 66,362,836 M449L probably benign Het
Ccdc81 T A 7: 89,877,578 probably null Het
Cd209b A T 8: 3,926,559 C42* probably null Het
Cirh1a A T 8: 106,916,221 T504S probably benign Het
Clec18a A T 8: 111,082,057 M11K probably benign Het
Clock A T 5: 76,254,422 S130R probably benign Het
Col12a1 G A 9: 79,605,183 A2910V possibly damaging Het
Col6a4 C T 9: 106,075,215 A495T probably benign Het
Cyp4f37 A T 17: 32,634,978 N467I probably damaging Het
Ddo G A 10: 40,637,379 V106M possibly damaging Het
Dennd5a A G 7: 109,901,125 L931P probably damaging Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Dnah7b T C 1: 46,139,872 S902P probably damaging Het
Dnal4 T G 15: 79,762,510 I57L probably benign Het
Dst T A 1: 34,117,511 I174N probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efhb T C 17: 53,449,535 T363A probably damaging Het
Eif4g1 A G 16: 20,688,828 D1453G probably benign Het
Fam102b G A 3: 109,027,342 probably benign Het
Fbp1 T C 13: 62,869,017 I224V probably benign Het
Gm10782 T G 13: 56,363,135 F79V noncoding transcript Het
Gm281 G A 14: 13,814,954 Q860* probably null Het
Gm498 A G 7: 143,883,943 N126S possibly damaging Het
Gpaa1 C G 15: 76,331,960 R47G possibly damaging Het
Hs2st1 G A 3: 144,437,604 S226L possibly damaging Het
Hydin A G 8: 110,607,902 Y4992C probably benign Het
Ikbke A T 1: 131,263,328 C549* probably null Het
Insrr G A 3: 87,810,442 G817S probably benign Het
Itgb5 G A 16: 33,865,553 V88I probably benign Het
Krt78 A G 15: 101,946,487 V963A probably benign Het
Lars T C 18: 42,243,028 Y239C possibly damaging Het
Map2k5 A G 9: 63,339,079 probably null Het
Mfn2 A T 4: 147,890,236 W118R probably benign Het
Mga T A 2: 119,960,930 I2550N probably damaging Het
Mgam A G 6: 40,745,177 I401V possibly damaging Het
Mrps18c A G 5: 100,804,398 Y141C probably damaging Het
Myo1e A T 9: 70,346,763 I565L possibly damaging Het
Nfatc4 G A 14: 55,826,391 E112K probably damaging Het
Nubp1 A G 16: 10,421,622 M255V probably benign Het
Olfr622 A G 7: 103,639,451 S230P probably damaging Het
Olfr702 A C 7: 106,824,413 S38A probably benign Het
Olfr952 C T 9: 39,426,670 V134I probably benign Het
Pask A T 1: 93,312,851 C1264* probably null Het
Pcgf2 T C 11: 97,691,743 T173A probably benign Het
Plcg1 T C 2: 160,753,933 I574T probably benign Het
Plin4 T C 17: 56,104,437 T865A probably damaging Het
Pnpt1 T C 11: 29,153,277 V514A probably benign Het
Ppp1r3a T A 6: 14,719,701 I405F probably benign Het
Qpctl A G 7: 19,148,473 V86A probably benign Het
Rab3gap1 G T 1: 127,909,918 W239L possibly damaging Het
Ralgapa2 T A 2: 146,404,866 T939S possibly damaging Het
Rapgef2 G T 3: 79,083,202 T923N possibly damaging Het
Rit2 T A 18: 31,153,845 I96F probably damaging Het
Rnase13 A T 14: 51,922,436 I82N probably damaging Het
Rp1 C A 1: 4,347,089 V1267L probably benign Het
Serpinb9b G A 13: 33,039,571 E249K probably damaging Het
Serpinb9c G T 13: 33,150,111 T344K possibly damaging Het
Serpinh1 T C 7: 99,348,944 I160V possibly damaging Het
Sipa1 A G 19: 5,654,936 S544P probably damaging Het
Slc17a5 A T 9: 78,571,029 Y231* probably null Het
Srcap T C 7: 127,549,357 V1959A probably damaging Het
Srrm4 G A 5: 116,591,567 probably benign Het
Stat1 T C 1: 52,151,245 I553T possibly damaging Het
Stpg1 A G 4: 135,529,592 I231M probably benign Het
Szt2 G GC 4: 118,375,482 probably null Het
Trpv3 C T 11: 73,279,921 T209M probably damaging Het
Tsc22d2 G T 3: 58,417,123 G479C unknown Het
Ttc3 A G 16: 94,466,979 H1950R probably damaging Het
Tusc3 A G 8: 39,164,841 *348W probably null Het
Vmn1r15 A G 6: 57,258,650 M168V probably benign Het
Wdr34 A G 2: 30,032,189 L420P probably damaging Het
Wdr60 T C 12: 116,256,085 E79G probably damaging Het
Xrcc5 T A 1: 72,319,127 M207K possibly damaging Het
Zdbf2 T A 1: 63,306,591 N1376K possibly damaging Het
Zfp558 A C 9: 18,456,917 S192A probably benign Het
Zfp964 A G 8: 69,663,274 T175A possibly damaging Het
Zfp988 A G 4: 147,332,308 R400G probably damaging Het
Other mutations in Ehbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Ehbp1l1 APN 19 5717933 missense probably benign 0.33
IGL01061:Ehbp1l1 APN 19 5717888 missense probably benign
IGL01372:Ehbp1l1 APN 19 5715789 splice site probably benign
IGL01790:Ehbp1l1 APN 19 5722984 missense probably damaging 0.99
IGL01936:Ehbp1l1 APN 19 5718249 nonsense probably null
IGL02194:Ehbp1l1 APN 19 5718857 missense probably benign
IGL02347:Ehbp1l1 APN 19 5719572 missense possibly damaging 0.72
IGL02372:Ehbp1l1 APN 19 5710834 missense possibly damaging 0.53
IGL02681:Ehbp1l1 APN 19 5720825 missense probably damaging 0.98
IGL02824:Ehbp1l1 APN 19 5719298 missense probably benign
IGL03070:Ehbp1l1 APN 19 5715953 missense probably benign 0.33
IGL03146:Ehbp1l1 APN 19 5720033 missense probably benign 0.00
PIT4802001:Ehbp1l1 UTSW 19 5719575 missense possibly damaging 0.93
R0309:Ehbp1l1 UTSW 19 5720570 missense possibly damaging 0.72
R0787:Ehbp1l1 UTSW 19 5722668 missense possibly damaging 0.95
R1156:Ehbp1l1 UTSW 19 5708336 unclassified probably benign
R1337:Ehbp1l1 UTSW 19 5718230 missense probably benign 0.00
R1474:Ehbp1l1 UTSW 19 5719084 missense possibly damaging 0.86
R1501:Ehbp1l1 UTSW 19 5716424 missense probably damaging 0.98
R1582:Ehbp1l1 UTSW 19 5721967 missense possibly damaging 0.83
R1766:Ehbp1l1 UTSW 19 5716406 missense probably damaging 0.98
R1838:Ehbp1l1 UTSW 19 5717691 missense probably benign 0.39
R1842:Ehbp1l1 UTSW 19 5725930 missense probably damaging 0.99
R1863:Ehbp1l1 UTSW 19 5717854 missense probably benign 0.01
R1955:Ehbp1l1 UTSW 19 5710669 missense possibly damaging 0.51
R2010:Ehbp1l1 UTSW 19 5719283 missense probably benign
R2098:Ehbp1l1 UTSW 19 5708658 missense possibly damaging 0.93
R2099:Ehbp1l1 UTSW 19 5718401 missense possibly damaging 0.72
R2852:Ehbp1l1 UTSW 19 5716487 missense probably damaging 0.99
R3113:Ehbp1l1 UTSW 19 5718980 missense probably benign 0.38
R3799:Ehbp1l1 UTSW 19 5719115 missense probably benign 0.33
R3891:Ehbp1l1 UTSW 19 5718312 missense possibly damaging 0.73
R3964:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R3966:Ehbp1l1 UTSW 19 5710573 critical splice donor site probably null
R4335:Ehbp1l1 UTSW 19 5708769 missense probably damaging 0.98
R4434:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R4457:Ehbp1l1 UTSW 19 5716293 missense possibly damaging 0.83
R4597:Ehbp1l1 UTSW 19 5717927 missense possibly damaging 0.72
R4726:Ehbp1l1 UTSW 19 5719176 missense possibly damaging 0.70
R4761:Ehbp1l1 UTSW 19 5719847 missense possibly damaging 0.93
R4771:Ehbp1l1 UTSW 19 5725968 missense probably damaging 1.00
R5402:Ehbp1l1 UTSW 19 5716320 missense possibly damaging 0.91
R5436:Ehbp1l1 UTSW 19 5716248 missense possibly damaging 0.93
R5602:Ehbp1l1 UTSW 19 5708670 missense possibly damaging 0.85
R5893:Ehbp1l1 UTSW 19 5718431 missense probably benign
R6329:Ehbp1l1 UTSW 19 5718767 missense possibly damaging 0.53
R6416:Ehbp1l1 UTSW 19 5718757 missense probably benign 0.01
R7106:Ehbp1l1 UTSW 19 5718737 missense probably benign 0.33
R7262:Ehbp1l1 UTSW 19 5718446 nonsense probably null
R7304:Ehbp1l1 UTSW 19 5716382 missense probably damaging 1.00
R7317:Ehbp1l1 UTSW 19 5720702 missense probably benign 0.44
R7404:Ehbp1l1 UTSW 19 5720844 missense possibly damaging 0.72
R7447:Ehbp1l1 UTSW 19 5719428 missense possibly damaging 0.53
R7862:Ehbp1l1 UTSW 19 5720823 missense probably benign
R7881:Ehbp1l1 UTSW 19 5719398 missense probably benign
R7910:Ehbp1l1 UTSW 19 5716424 missense probably benign 0.28
R8239:Ehbp1l1 UTSW 19 5720061 missense possibly damaging 0.53
R8324:Ehbp1l1 UTSW 19 5719998 missense possibly damaging 0.86
RF053:Ehbp1l1 UTSW 19 5716002 small deletion probably benign
Z1088:Ehbp1l1 UTSW 19 5716287 missense possibly damaging 0.77
Z1176:Ehbp1l1 UTSW 19 5717889 missense probably benign
Z1177:Ehbp1l1 UTSW 19 5718762 missense probably damaging 0.99
Z1177:Ehbp1l1 UTSW 19 5719101 missense probably benign 0.07
Z1177:Ehbp1l1 UTSW 19 5719102 missense probably benign 0.01
Z1177:Ehbp1l1 UTSW 19 5719434 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATCTTATCTCCAGCCACAGC -3'
(R):5'- AGTGCTCTCTGGTGACCTTG -3'

Sequencing Primer
(F):5'- CACCTGCTTGTTGTTCTGTTTGATG -3'
(R):5'- TGACCTTGTAAGCTCAGAGC -3'
Posted On2020-07-28