Incidental Mutation 'R0100:Ccdc51'
ID64131
Institutional Source Beutler Lab
Gene Symbol Ccdc51
Ensembl Gene ENSMUSG00000025645
Gene Namecoiled-coil domain containing 51
Synonyms5730568A12Rik
MMRRC Submission 038386-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R0100 (G1)
Quality Score154
Status Validated
Chromosome9
Chromosomal Location109082493-109092489 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 109091998 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 318 (Q318*)
Ref Sequence ENSEMBL: ENSMUSP00000026735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026735] [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
Predicted Effect probably null
Transcript: ENSMUST00000026735
AA Change: Q318*
SMART Domains Protein: ENSMUSP00000026735
Gene: ENSMUSG00000025645
AA Change: Q318*

DomainStartEndE-ValueType
coiled coil region 109 162 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
low complexity region 274 286 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072093
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130366
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134690
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,254,011 I442T possibly damaging Het
Agrn A G 4: 156,174,958 C814R probably damaging Het
Bbof1 T A 12: 84,411,055 D31E probably benign Het
Cpxm2 T A 7: 132,054,871 H554L possibly damaging Het
Dbr1 T A 9: 99,583,669 D433E probably benign Het
Ddx55 C T 5: 124,556,782 T91I probably damaging Het
Dhx57 T C 17: 80,275,156 D340G possibly damaging Het
Dnah1 C T 14: 31,262,152 probably null Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Fam81a C T 9: 70,102,809 probably benign Het
Fat4 A C 3: 38,980,248 N2683T probably damaging Het
Fbxo47 C T 11: 97,868,606 G165S probably damaging Het
Gpatch2 C A 1: 187,225,817 A123E probably damaging Het
Greb1 T A 12: 16,680,224 Q1734L probably benign Het
Gtf2ird2 T C 5: 134,217,015 L705P probably damaging Het
H13 T A 2: 152,689,863 probably null Het
Hip1 T C 5: 135,436,453 D367G probably benign Het
Ift140 C T 17: 25,090,954 Q1112* probably null Het
Il17b A G 18: 61,690,271 M59V probably benign Het
Lpin3 T C 2: 160,905,340 Y829H probably damaging Het
Mocs3 C T 2: 168,231,190 R186C probably damaging Het
Olfr1105 T C 2: 87,033,595 T209A probably benign Het
Olfr121 T C 17: 37,752,703 F283S probably benign Het
Olfr1225 T A 2: 89,171,087 I42F probably benign Het
Olfr1344 C T 7: 6,440,400 R167C probably damaging Het
Osgepl1 A G 1: 53,323,213 I405V probably damaging Het
Pdcd11 T C 19: 47,102,666 S360P probably benign Het
Plekhs1 A G 19: 56,478,502 E255G probably damaging Het
Tex22 T A 12: 113,088,772 I150N probably benign Het
Tmem106a T C 11: 101,586,258 S98P probably benign Het
Tnfrsf18 A G 4: 156,028,366 T170A probably benign Het
Trpc6 C T 9: 8,653,034 P614S probably damaging Het
Usp28 C A 9: 49,035,932 P566Q probably damaging Het
Washc5 A G 15: 59,344,098 F811L possibly damaging Het
Other mutations in Ccdc51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Ccdc51 APN 9 109092184 missense probably damaging 1.00
IGL02615:Ccdc51 APN 9 109089435 missense probably benign
IGL02806:Ccdc51 APN 9 109092248 missense probably benign 0.00
R0137:Ccdc51 UTSW 9 109091630 missense probably damaging 1.00
R0211:Ccdc51 UTSW 9 109089373 missense probably benign 0.01
R0211:Ccdc51 UTSW 9 109089373 missense probably benign 0.01
R4540:Ccdc51 UTSW 9 109092220 missense possibly damaging 0.50
R4669:Ccdc51 UTSW 9 109090962 missense probably benign 0.00
R4770:Ccdc51 UTSW 9 109090910 missense probably benign
R5364:Ccdc51 UTSW 9 109092120 missense possibly damaging 0.82
R6137:Ccdc51 UTSW 9 109089415 missense probably benign 0.21
R7146:Ccdc51 UTSW 9 109091780 missense probably damaging 1.00
R7831:Ccdc51 UTSW 9 109091990 missense probably damaging 1.00
R7886:Ccdc51 UTSW 9 109091587 missense probably damaging 1.00
Z1176:Ccdc51 UTSW 9 109092148 nonsense probably null
Z1176:Ccdc51 UTSW 9 109092226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTACTCCTGGAAGCACAGAAAG -3'
(R):5'- TCTCTGACAGGGCCAAGATCACAC -3'

Sequencing Primer
(F):5'- AGACCTCCAGGACCTTATGATGG -3'
(R):5'- ACTCCCGTGTTCCAGCAAG -3'
Posted On2013-08-06