Incidental Mutation 'R8310:Lce1l'
ID641311
Institutional Source Beutler Lab
Gene Symbol Lce1l
Ensembl Gene ENSMUSG00000046676
Gene Namelate cornified envelope 1L
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8310 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location92849949-92851286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 92850459 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 31 (P31A)
Ref Sequence ENSEMBL: ENSMUSP00000057762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054426]
Predicted Effect unknown
Transcript: ENSMUST00000054426
AA Change: P31A
SMART Domains Protein: ENSMUSP00000057762
Gene: ENSMUSG00000046676
AA Change: P31A

DomainStartEndE-ValueType
Pfam:LCE 25 67 1.6e-12 PFAM
Pfam:LCE 65 135 2.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T G 13: 48,514,251 W10G unknown Het
Abca13 A T 11: 9,378,269 K3447N possibly damaging Het
Agtr1a T G 13: 30,381,762 V270G probably benign Het
Apob A T 12: 8,009,033 H2505L probably benign Het
Babam1 T A 8: 71,397,985 V86D possibly damaging Het
Cacna1s C A 1: 136,087,337 N654K probably damaging Het
Ccdc8 T C 7: 16,995,401 S272P probably damaging Het
Cnksr1 T C 4: 134,229,419 E510G probably damaging Het
Cnot6l A T 5: 96,091,676 D255E probably benign Het
Dyrk1a A G 16: 94,691,791 T628A probably benign Het
Elavl1 A T 8: 4,301,786 I110N probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Erich3 C T 3: 154,704,949 T147I Het
Galnt1 A T 18: 24,271,629 H341L probably damaging Het
Gm14325 A T 2: 177,831,799 C497S probably damaging Het
Gm4922 A T 10: 18,783,788 N395K probably benign Het
Hsd17b2 G A 8: 117,742,416 C189Y probably damaging Het
Kcnn1 A T 8: 70,852,805 S254T possibly damaging Het
Lrpprc A G 17: 84,773,096 Y199H probably damaging Het
Lrrtm3 A T 10: 64,089,708 probably null Het
Mon2 G T 10: 123,002,783 A1598E probably damaging Het
Myh3 A T 11: 67,096,007 probably null Het
Naa11 A T 5: 97,391,878 D140E probably damaging Het
Nadk2 G A 15: 9,103,332 R350Q probably benign Het
Npc1 T C 18: 12,193,398 I1162V probably damaging Het
Olfr110 T C 17: 37,499,257 I202T probably benign Het
Olfr1508 A G 14: 52,463,823 M62T probably damaging Het
Otogl A T 10: 107,777,600 N2001K possibly damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pi4ka A G 16: 17,354,048 probably null Het
Ppp2r5c A T 12: 110,545,825 T185S possibly damaging Het
Psd2 A T 18: 35,979,713 S154C probably damaging Het
Rnasel G A 1: 153,754,988 V417M possibly damaging Het
Slc35g2 A G 9: 100,552,788 S277P probably damaging Het
Slc36a2 A T 11: 55,179,332 W140R possibly damaging Het
Slc6a12 A G 6: 121,363,291 K512E probably damaging Het
Sox7 C T 14: 63,943,826 S24L probably benign Het
Specc1 A G 11: 62,132,345 K659E probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Syne1 A G 10: 5,347,829 M1156T probably benign Het
Tars2 T A 3: 95,750,959 I185F probably benign Het
Thsd7a T C 6: 12,396,613 I839V Het
Vmn1r115 T C 7: 20,844,894 N31S probably damaging Het
Vmn1r57 A G 7: 5,221,025 D183G probably damaging Het
Wdr7 C T 18: 63,735,685 T275I probably damaging Het
Ybx2 A G 11: 69,940,368 E263G probably damaging Het
Zbtb6 G T 2: 37,429,884 Q11K probably benign Het
Zfp329 A T 7: 12,810,189 C469* probably null Het
Zfp868 A T 8: 69,613,795 L40H probably damaging Het
Other mutations in Lce1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03202:Lce1l APN 3 92850324 missense unknown
R1724:Lce1l UTSW 3 92850419 missense unknown
R4075:Lce1l UTSW 3 92850233 missense unknown
R4515:Lce1l UTSW 3 92850474 missense unknown
R5531:Lce1l UTSW 3 92850497 missense unknown
R6785:Lce1l UTSW 3 92850193 nonsense probably null
R7298:Lce1l UTSW 3 92850176 missense unknown
R8312:Lce1l UTSW 3 92850459 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGATGGCGACGAAGAGATC -3'
(R):5'- GTTTGTCTTGGAATCAGTGTCTAACAG -3'

Sequencing Primer
(F):5'- CGAAGAGATCTGTGAGGCCTGTG -3'
(R):5'- CAGAATTGAGGATGGATATGTCTGC -3'
Posted On2020-07-28