Incidental Mutation 'R8310:Erich3'
ID641313
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8310 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 154704949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 147 (T147I)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496]
Predicted Effect
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: T147I

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T G 13: 48,514,251 W10G unknown Het
Abca13 A T 11: 9,378,269 K3447N possibly damaging Het
Agtr1a T G 13: 30,381,762 V270G probably benign Het
Apob A T 12: 8,009,033 H2505L probably benign Het
Babam1 T A 8: 71,397,985 V86D possibly damaging Het
Cacna1s C A 1: 136,087,337 N654K probably damaging Het
Ccdc8 T C 7: 16,995,401 S272P probably damaging Het
Cnksr1 T C 4: 134,229,419 E510G probably damaging Het
Cnot6l A T 5: 96,091,676 D255E probably benign Het
Dyrk1a A G 16: 94,691,791 T628A probably benign Het
Elavl1 A T 8: 4,301,786 I110N probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Galnt1 A T 18: 24,271,629 H341L probably damaging Het
Gm14325 A T 2: 177,831,799 C497S probably damaging Het
Gm4922 A T 10: 18,783,788 N395K probably benign Het
Hsd17b2 G A 8: 117,742,416 C189Y probably damaging Het
Kcnn1 A T 8: 70,852,805 S254T possibly damaging Het
Lce1l G C 3: 92,850,459 P31A unknown Het
Lrpprc A G 17: 84,773,096 Y199H probably damaging Het
Lrrtm3 A T 10: 64,089,708 probably null Het
Mon2 G T 10: 123,002,783 A1598E probably damaging Het
Myh3 A T 11: 67,096,007 probably null Het
Naa11 A T 5: 97,391,878 D140E probably damaging Het
Nadk2 G A 15: 9,103,332 R350Q probably benign Het
Npc1 T C 18: 12,193,398 I1162V probably damaging Het
Olfr110 T C 17: 37,499,257 I202T probably benign Het
Olfr1508 A G 14: 52,463,823 M62T probably damaging Het
Otogl A T 10: 107,777,600 N2001K possibly damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pi4ka A G 16: 17,354,048 probably null Het
Ppp2r5c A T 12: 110,545,825 T185S possibly damaging Het
Psd2 A T 18: 35,979,713 S154C probably damaging Het
Rnasel G A 1: 153,754,988 V417M possibly damaging Het
Slc35g2 A G 9: 100,552,788 S277P probably damaging Het
Slc36a2 A T 11: 55,179,332 W140R possibly damaging Het
Slc6a12 A G 6: 121,363,291 K512E probably damaging Het
Sox7 C T 14: 63,943,826 S24L probably benign Het
Specc1 A G 11: 62,132,345 K659E probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Syne1 A G 10: 5,347,829 M1156T probably benign Het
Tars2 T A 3: 95,750,959 I185F probably benign Het
Thsd7a T C 6: 12,396,613 I839V Het
Vmn1r115 T C 7: 20,844,894 N31S probably damaging Het
Vmn1r57 A G 7: 5,221,025 D183G probably damaging Het
Wdr7 C T 18: 63,735,685 T275I probably damaging Het
Ybx2 A G 11: 69,940,368 E263G probably damaging Het
Zbtb6 G T 2: 37,429,884 Q11K probably benign Het
Zfp329 A T 7: 12,810,189 C469* probably null Het
Zfp868 A T 8: 69,613,795 L40H probably damaging Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
R7400:Erich3 UTSW 3 154762577 missense
R7421:Erich3 UTSW 3 154733561 missense probably damaging 1.00
R7520:Erich3 UTSW 3 154763126 missense unknown
R7553:Erich3 UTSW 3 154733500 missense probably benign 0.01
R7751:Erich3 UTSW 3 154763789 missense unknown
R7768:Erich3 UTSW 3 154748331 missense probably benign 0.00
R7955:Erich3 UTSW 3 154739314 nonsense probably null
R8001:Erich3 UTSW 3 154713916 missense probably benign 0.21
R8101:Erich3 UTSW 3 154733513 missense probably damaging 0.99
R8108:Erich3 UTSW 3 154720115 missense possibly damaging 0.91
R8162:Erich3 UTSW 3 154764573 missense unknown
Z1176:Erich3 UTSW 3 154698701 missense
Z1176:Erich3 UTSW 3 154762430 missense
Predicted Primers PCR Primer
(F):5'- AGGCACTAAGCTAACCTGATC -3'
(R):5'- ACCCATAGCCATTTCCGTTGG -3'

Sequencing Primer
(F):5'- AGCTAACCTGATCACCTATATGTC -3'
(R):5'- GGGGACTTGCAATGCTGAC -3'
Posted On2020-07-28