Incidental Mutation 'R8310:Cnot6l'
ID641316
Institutional Source Beutler Lab
Gene Symbol Cnot6l
Ensembl Gene ENSMUSG00000034724
Gene NameCCR4-NOT transcription complex, subunit 6-like
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R8310 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location96070333-96164171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96091676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 255 (D255E)
Ref Sequence ENSEMBL: ENSMUSP00000119415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036646] [ENSMUST00000113005] [ENSMUST00000122003] [ENSMUST00000155901]
Predicted Effect probably benign
Transcript: ENSMUST00000036646
Predicted Effect probably benign
Transcript: ENSMUST00000113005
AA Change: D260E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108629
Gene: ENSMUSG00000034724
AA Change: D260E

DomainStartEndE-ValueType
LRR 55 77 4.34e-1 SMART
LRR 78 100 1.01e-1 SMART
LRR 101 124 7.55e-1 SMART
Pfam:Exo_endo_phos 192 529 7.3e-22 PFAM
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122003
AA Change: D255E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113821
Gene: ENSMUSG00000034724
AA Change: D255E

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 433 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155901
AA Change: D255E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119415
Gene: ENSMUSG00000034724
AA Change: D255E

DomainStartEndE-ValueType
LRR 50 72 4.34e-1 SMART
LRR 73 95 1.01e-1 SMART
LRR 96 119 7.55e-1 SMART
Pfam:Exo_endo_phos 187 524 2.2e-23 PFAM
low complexity region 527 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T G 13: 48,514,251 W10G unknown Het
Abca13 A T 11: 9,378,269 K3447N possibly damaging Het
Agtr1a T G 13: 30,381,762 V270G probably benign Het
Apob A T 12: 8,009,033 H2505L probably benign Het
Babam1 T A 8: 71,397,985 V86D possibly damaging Het
Cacna1s C A 1: 136,087,337 N654K probably damaging Het
Ccdc8 T C 7: 16,995,401 S272P probably damaging Het
Cnksr1 T C 4: 134,229,419 E510G probably damaging Het
Dyrk1a A G 16: 94,691,791 T628A probably benign Het
Elavl1 A T 8: 4,301,786 I110N probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Erich3 C T 3: 154,704,949 T147I Het
Galnt1 A T 18: 24,271,629 H341L probably damaging Het
Gm14325 A T 2: 177,831,799 C497S probably damaging Het
Gm4922 A T 10: 18,783,788 N395K probably benign Het
Hsd17b2 G A 8: 117,742,416 C189Y probably damaging Het
Kcnn1 A T 8: 70,852,805 S254T possibly damaging Het
Lce1l G C 3: 92,850,459 P31A unknown Het
Lrpprc A G 17: 84,773,096 Y199H probably damaging Het
Lrrtm3 A T 10: 64,089,708 probably null Het
Mon2 G T 10: 123,002,783 A1598E probably damaging Het
Myh3 A T 11: 67,096,007 probably null Het
Naa11 A T 5: 97,391,878 D140E probably damaging Het
Nadk2 G A 15: 9,103,332 R350Q probably benign Het
Npc1 T C 18: 12,193,398 I1162V probably damaging Het
Olfr110 T C 17: 37,499,257 I202T probably benign Het
Olfr1508 A G 14: 52,463,823 M62T probably damaging Het
Otogl A T 10: 107,777,600 N2001K possibly damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pi4ka A G 16: 17,354,048 probably null Het
Ppp2r5c A T 12: 110,545,825 T185S possibly damaging Het
Psd2 A T 18: 35,979,713 S154C probably damaging Het
Rnasel G A 1: 153,754,988 V417M possibly damaging Het
Slc35g2 A G 9: 100,552,788 S277P probably damaging Het
Slc36a2 A T 11: 55,179,332 W140R possibly damaging Het
Slc6a12 A G 6: 121,363,291 K512E probably damaging Het
Sox7 C T 14: 63,943,826 S24L probably benign Het
Specc1 A G 11: 62,132,345 K659E probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Syne1 A G 10: 5,347,829 M1156T probably benign Het
Tars2 T A 3: 95,750,959 I185F probably benign Het
Thsd7a T C 6: 12,396,613 I839V Het
Vmn1r115 T C 7: 20,844,894 N31S probably damaging Het
Vmn1r57 A G 7: 5,221,025 D183G probably damaging Het
Wdr7 C T 18: 63,735,685 T275I probably damaging Het
Ybx2 A G 11: 69,940,368 E263G probably damaging Het
Zbtb6 G T 2: 37,429,884 Q11K probably benign Het
Zfp329 A T 7: 12,810,189 C469* probably null Het
Zfp868 A T 8: 69,613,795 L40H probably damaging Het
Other mutations in Cnot6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Cnot6l APN 5 96086246 missense probably damaging 1.00
IGL02102:Cnot6l APN 5 96091659 missense probably damaging 0.98
BB005:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
BB015:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
R0443:Cnot6l UTSW 5 96091745 splice site probably benign
R0448:Cnot6l UTSW 5 96080046 missense probably benign 0.00
R1436:Cnot6l UTSW 5 96134112 missense probably damaging 1.00
R2198:Cnot6l UTSW 5 96079941 missense possibly damaging 0.79
R4240:Cnot6l UTSW 5 96077362 missense probably benign
R4506:Cnot6l UTSW 5 96086174 missense possibly damaging 0.93
R4624:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4627:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4629:Cnot6l UTSW 5 96077211 missense probably benign 0.05
R4868:Cnot6l UTSW 5 96083023 missense probably damaging 1.00
R4936:Cnot6l UTSW 5 96079937 missense probably damaging 1.00
R5597:Cnot6l UTSW 5 96131119 missense probably damaging 1.00
R5781:Cnot6l UTSW 5 96086165 missense probably benign 0.31
R6142:Cnot6l UTSW 5 96082978 missense probably benign 0.00
R6166:Cnot6l UTSW 5 96079940 missense possibly damaging 0.79
R6189:Cnot6l UTSW 5 96098277 missense probably benign 0.18
R6382:Cnot6l UTSW 5 96128999 missense probably damaging 0.99
R6515:Cnot6l UTSW 5 96161678 intron probably benign
R6773:Cnot6l UTSW 5 96094299 missense probably damaging 1.00
R7326:Cnot6l UTSW 5 96077299 missense probably benign 0.00
R7466:Cnot6l UTSW 5 96131128 missense probably benign 0.01
R7832:Cnot6l UTSW 5 96094225 missense possibly damaging 0.90
R7928:Cnot6l UTSW 5 96131068 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAACCTCATAAAAGCAGGG -3'
(R):5'- GCACATGTCAAACACAATTGCTTG -3'

Sequencing Primer
(F):5'- CCAGGAAGGGGGCTAACATTTG -3'
(R):5'- ACAATTGCTTGTGATAAGATTGCTGG -3'
Posted On2020-07-28