Incidental Mutation 'R8310:Myh3'
ID641339
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R8310 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 67096007 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect probably null
Transcript: ENSMUST00000007301
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108689
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165221
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T G 13: 48,514,251 W10G unknown Het
Abca13 A T 11: 9,378,269 K3447N possibly damaging Het
Agtr1a T G 13: 30,381,762 V270G probably benign Het
Apob A T 12: 8,009,033 H2505L probably benign Het
Babam1 T A 8: 71,397,985 V86D possibly damaging Het
Cacna1s C A 1: 136,087,337 N654K probably damaging Het
Ccdc146 A T 5: 21,301,471 probably benign Het
Ccdc8 T C 7: 16,995,401 S272P probably damaging Het
Cnksr1 T C 4: 134,229,419 E510G probably damaging Het
Cnot6l A T 5: 96,091,676 D255E probably benign Het
Ddx1 A C 12: 13,224,279 probably benign Het
Dyrk1a A G 16: 94,691,791 T628A probably benign Het
Elavl1 A T 8: 4,301,786 I110N probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Erich3 C T 3: 154,704,949 T147I Het
Galnt1 A T 18: 24,271,629 H341L probably damaging Het
Gm14325 A T 2: 177,831,799 C497S probably damaging Het
Gm4922 A T 10: 18,783,788 N395K probably benign Het
Hsd17b2 G A 8: 117,742,416 C189Y probably damaging Het
Kcnn1 A T 8: 70,852,805 S254T possibly damaging Het
Lce1l G C 3: 92,850,459 P31A unknown Het
Lrpprc A G 17: 84,773,096 Y199H probably damaging Het
Lrrtm3 A T 10: 64,089,708 probably null Het
Mon2 G T 10: 123,002,783 A1598E probably damaging Het
Naa11 A T 5: 97,391,878 D140E probably damaging Het
Nadk2 G A 15: 9,103,332 R350Q probably benign Het
Npc1 T C 18: 12,193,398 I1162V probably damaging Het
Olfr110 T C 17: 37,499,257 I202T probably benign Het
Olfr1508 A G 14: 52,463,823 M62T probably damaging Het
Otogl A T 10: 107,777,600 N2001K possibly damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pi4ka A G 16: 17,354,048 probably null Het
Ppp2r5c A T 12: 110,545,825 T185S possibly damaging Het
Psd2 A T 18: 35,979,713 S154C probably damaging Het
Rnasel G A 1: 153,754,988 V417M possibly damaging Het
Slc35g2 A G 9: 100,552,788 S277P probably damaging Het
Slc36a2 A T 11: 55,179,332 W140R possibly damaging Het
Slc6a12 A G 6: 121,363,291 K512E probably damaging Het
Sox7 C T 14: 63,943,826 S24L probably benign Het
Specc1 A G 11: 62,132,345 K659E probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Syne1 A G 10: 5,347,829 M1156T probably benign Het
Tars2 T A 3: 95,750,959 I185F probably benign Het
Thsd7a T C 6: 12,396,613 I839V Het
Vmn1r115 T C 7: 20,844,894 N31S probably damaging Het
Vmn1r57 A G 7: 5,221,025 D183G probably damaging Het
Wdr7 C T 18: 63,735,685 T275I probably damaging Het
Ybx2 A G 11: 69,940,368 E263G probably damaging Het
Zbtb6 G T 2: 37,429,884 Q11K probably benign Het
Zfp329 A T 7: 12,810,189 C469* probably null Het
Zfp868 A T 8: 69,613,795 L40H probably damaging Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
bud UTSW 11 67096007 critical splice acceptor site probably null
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8169:Myh3 UTSW 11 67089030 missense probably benign 0.06
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8255:Myh3 UTSW 11 67095022 missense probably damaging 1.00
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCTGCTATTTGCTTTTCAGGGATAC -3'
(R):5'- AGCACACAAGTCAGATGCGC -3'

Sequencing Primer
(F):5'- GGATACACCCCTACTCTCAAGAGG -3'
(R):5'- GCACTGGCTGAATCATCACTTC -3'
Posted On2020-07-28