Incidental Mutation 'R0100:Greb1'
ID 64134
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
MMRRC Submission 038386-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0100 (G1)
Quality Score 100
Status Validated
Chromosome 12
Chromosomal Location 16720616-16850887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 16730225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1734 (Q1734L)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect probably benign
Transcript: ENSMUST00000048064
AA Change: Q1734L

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: Q1734L

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159120
AA Change: Q1706L

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: Q1706L

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160755
Predicted Effect probably benign
Transcript: ENSMUST00000162112
AA Change: Q1734L

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: Q1734L

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223113
Meta Mutation Damage Score 0.5184 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrn A G 4: 156,259,415 (GRCm39) C814R probably damaging Het
Bbof1 T A 12: 84,457,829 (GRCm39) D31E probably benign Het
Ccdc51 C T 9: 108,921,066 (GRCm39) Q318* probably null Het
Cpxm2 T A 7: 131,656,600 (GRCm39) H554L possibly damaging Het
Dbr1 T A 9: 99,465,722 (GRCm39) D433E probably benign Het
Ddx55 C T 5: 124,694,845 (GRCm39) T91I probably damaging Het
Dhx57 T C 17: 80,582,585 (GRCm39) D340G possibly damaging Het
Dnah1 C T 14: 30,984,109 (GRCm39) probably null Het
Dpp9 C T 17: 56,512,854 (GRCm39) G118D possibly damaging Het
Fam81a C T 9: 70,010,091 (GRCm39) probably benign Het
Fat4 A C 3: 39,034,397 (GRCm39) N2683T probably damaging Het
Fbxo47 C T 11: 97,759,432 (GRCm39) G165S probably damaging Het
Garre1 A G 7: 33,953,436 (GRCm39) I442T possibly damaging Het
Gpatch2 C A 1: 186,958,014 (GRCm39) A123E probably damaging Het
Gtf2ird2 T C 5: 134,245,857 (GRCm39) L705P probably damaging Het
H13 T A 2: 152,531,783 (GRCm39) probably null Het
Hip1 T C 5: 135,465,307 (GRCm39) D367G probably benign Het
Ift140 C T 17: 25,309,928 (GRCm39) Q1112* probably null Het
Il17b A G 18: 61,823,342 (GRCm39) M59V probably benign Het
Lpin3 T C 2: 160,747,260 (GRCm39) Y829H probably damaging Het
Mocs3 C T 2: 168,073,110 (GRCm39) R186C probably damaging Het
Or10al5 T C 17: 38,063,594 (GRCm39) F283S probably benign Het
Or2bd2 C T 7: 6,443,399 (GRCm39) R167C probably damaging Het
Or4c120 T A 2: 89,001,431 (GRCm39) I42F probably benign Het
Or5be3 T C 2: 86,863,939 (GRCm39) T209A probably benign Het
Osgepl1 A G 1: 53,362,372 (GRCm39) I405V probably damaging Het
Pdcd11 T C 19: 47,091,105 (GRCm39) S360P probably benign Het
Plekhs1 A G 19: 56,466,934 (GRCm39) E255G probably damaging Het
Tex22 T A 12: 113,052,392 (GRCm39) I150N probably benign Het
Tmem106a T C 11: 101,477,084 (GRCm39) S98P probably benign Het
Tnfrsf18 A G 4: 156,112,823 (GRCm39) T170A probably benign Het
Trpc6 C T 9: 8,653,035 (GRCm39) P614S probably damaging Het
Usp28 C A 9: 48,947,232 (GRCm39) P566Q probably damaging Het
Washc5 A G 15: 59,215,947 (GRCm39) F811L possibly damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16,761,962 (GRCm39) missense probably damaging 1.00
IGL01316:Greb1 APN 12 16,748,587 (GRCm39) missense probably benign 0.04
IGL01464:Greb1 APN 12 16,764,827 (GRCm39) missense probably damaging 0.99
IGL01474:Greb1 APN 12 16,734,502 (GRCm39) missense probably benign
IGL01522:Greb1 APN 12 16,751,202 (GRCm39) missense probably damaging 1.00
IGL01824:Greb1 APN 12 16,761,717 (GRCm39) nonsense probably null
IGL01837:Greb1 APN 12 16,734,452 (GRCm39) missense probably benign 0.19
IGL01991:Greb1 APN 12 16,749,682 (GRCm39) missense probably damaging 1.00
IGL01996:Greb1 APN 12 16,740,846 (GRCm39) missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16,756,233 (GRCm39) missense probably damaging 1.00
IGL02267:Greb1 APN 12 16,767,209 (GRCm39) missense probably benign 0.00
IGL02512:Greb1 APN 12 16,742,713 (GRCm39) missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16,756,296 (GRCm39) splice site probably benign
IGL02613:Greb1 APN 12 16,789,889 (GRCm39) critical splice donor site probably null
IGL02648:Greb1 APN 12 16,758,683 (GRCm39) missense probably damaging 1.00
IGL02679:Greb1 APN 12 16,758,724 (GRCm39) missense probably damaging 1.00
begraben UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
Eared UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
Humpback UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
pied_billed UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
rednecked UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16,783,332 (GRCm39) missense probably damaging 1.00
R0083:Greb1 UTSW 12 16,746,452 (GRCm39) missense probably benign
R0100:Greb1 UTSW 12 16,730,225 (GRCm39) missense probably benign 0.41
R0220:Greb1 UTSW 12 16,732,287 (GRCm39) missense probably damaging 1.00
R0245:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0540:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0547:Greb1 UTSW 12 16,773,412 (GRCm39) missense probably benign
R0563:Greb1 UTSW 12 16,730,268 (GRCm39) missense probably benign 0.23
R0607:Greb1 UTSW 12 16,732,194 (GRCm39) missense probably damaging 1.00
R0610:Greb1 UTSW 12 16,746,443 (GRCm39) missense probably benign
R0652:Greb1 UTSW 12 16,746,457 (GRCm39) missense probably damaging 1.00
R0659:Greb1 UTSW 12 16,730,213 (GRCm39) missense probably damaging 0.99
R0945:Greb1 UTSW 12 16,723,803 (GRCm39) missense probably benign 0.31
R1055:Greb1 UTSW 12 16,732,252 (GRCm39) missense probably damaging 0.98
R1445:Greb1 UTSW 12 16,757,852 (GRCm39) missense probably damaging 1.00
R1471:Greb1 UTSW 12 16,761,775 (GRCm39) missense probably damaging 0.97
R1503:Greb1 UTSW 12 16,774,820 (GRCm39) nonsense probably null
R1566:Greb1 UTSW 12 16,761,829 (GRCm39) missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16,751,172 (GRCm39) missense probably damaging 1.00
R1623:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R1751:Greb1 UTSW 12 16,773,439 (GRCm39) splice site probably benign
R1778:Greb1 UTSW 12 16,740,895 (GRCm39) missense probably benign
R1842:Greb1 UTSW 12 16,746,244 (GRCm39) missense probably damaging 1.00
R2040:Greb1 UTSW 12 16,752,651 (GRCm39) missense probably damaging 1.00
R2153:Greb1 UTSW 12 16,749,533 (GRCm39) missense probably damaging 1.00
R2178:Greb1 UTSW 12 16,746,388 (GRCm39) missense probably damaging 1.00
R2194:Greb1 UTSW 12 16,740,909 (GRCm39) missense probably benign 0.08
R2248:Greb1 UTSW 12 16,730,379 (GRCm39) missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16,764,954 (GRCm39) missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16,774,923 (GRCm39) missense probably damaging 1.00
R2860:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2861:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2862:Greb1 UTSW 12 16,761,746 (GRCm39) missense probably benign 0.28
R2866:Greb1 UTSW 12 16,749,551 (GRCm39) missense probably damaging 1.00
R2890:Greb1 UTSW 12 16,754,479 (GRCm39) missense probably damaging 1.00
R3056:Greb1 UTSW 12 16,738,592 (GRCm39) missense probably damaging 0.96
R3863:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3864:Greb1 UTSW 12 16,752,421 (GRCm39) missense probably damaging 1.00
R3956:Greb1 UTSW 12 16,732,300 (GRCm39) missense probably damaging 1.00
R4493:Greb1 UTSW 12 16,748,611 (GRCm39) missense probably benign 0.14
R4548:Greb1 UTSW 12 16,749,676 (GRCm39) missense probably damaging 1.00
R4683:Greb1 UTSW 12 16,761,774 (GRCm39) missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16,746,329 (GRCm39) missense probably damaging 1.00
R4770:Greb1 UTSW 12 16,731,357 (GRCm39) missense probably benign 0.03
R4838:Greb1 UTSW 12 16,734,361 (GRCm39) critical splice donor site probably null
R4925:Greb1 UTSW 12 16,731,472 (GRCm39) missense probably damaging 1.00
R4982:Greb1 UTSW 12 16,774,762 (GRCm39) missense probably damaging 0.98
R5009:Greb1 UTSW 12 16,774,858 (GRCm39) missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16,758,023 (GRCm39) intron probably benign
R5213:Greb1 UTSW 12 16,764,791 (GRCm39) nonsense probably null
R5310:Greb1 UTSW 12 16,766,760 (GRCm39) missense probably benign 0.09
R5353:Greb1 UTSW 12 16,738,567 (GRCm39) nonsense probably null
R5544:Greb1 UTSW 12 16,723,797 (GRCm39) missense probably damaging 1.00
R5605:Greb1 UTSW 12 16,758,727 (GRCm39) missense probably damaging 0.96
R5708:Greb1 UTSW 12 16,723,843 (GRCm39) missense probably benign 0.11
R5837:Greb1 UTSW 12 16,738,586 (GRCm39) missense probably damaging 1.00
R5890:Greb1 UTSW 12 16,783,422 (GRCm39) missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16,767,259 (GRCm39) missense probably damaging 1.00
R6049:Greb1 UTSW 12 16,731,395 (GRCm39) missense probably damaging 0.99
R6093:Greb1 UTSW 12 16,734,487 (GRCm39) missense probably benign
R6120:Greb1 UTSW 12 16,758,622 (GRCm39) missense probably damaging 0.99
R6175:Greb1 UTSW 12 16,724,771 (GRCm39) missense probably damaging 1.00
R6247:Greb1 UTSW 12 16,766,676 (GRCm39) missense probably damaging 1.00
R6274:Greb1 UTSW 12 16,785,152 (GRCm39) missense probably damaging 0.97
R6376:Greb1 UTSW 12 16,749,580 (GRCm39) missense probably damaging 0.97
R6523:Greb1 UTSW 12 16,734,374 (GRCm39) missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16,760,384 (GRCm39) missense probably benign 0.00
R6602:Greb1 UTSW 12 16,759,441 (GRCm39) missense probably benign 0.44
R6621:Greb1 UTSW 12 16,742,718 (GRCm39) missense probably damaging 1.00
R6645:Greb1 UTSW 12 16,748,580 (GRCm39) missense probably benign 0.07
R6725:Greb1 UTSW 12 16,738,568 (GRCm39) missense probably damaging 1.00
R6750:Greb1 UTSW 12 16,738,584 (GRCm39) missense probably benign 0.05
R6863:Greb1 UTSW 12 16,734,421 (GRCm39) missense probably damaging 1.00
R6914:Greb1 UTSW 12 16,757,903 (GRCm39) missense probably damaging 0.97
R6996:Greb1 UTSW 12 16,773,355 (GRCm39) missense probably benign 0.00
R7083:Greb1 UTSW 12 16,773,315 (GRCm39) missense probably benign
R7147:Greb1 UTSW 12 16,783,428 (GRCm39) missense probably damaging 1.00
R7238:Greb1 UTSW 12 16,724,673 (GRCm39) missense probably damaging 0.99
R7290:Greb1 UTSW 12 16,761,739 (GRCm39) missense probably damaging 1.00
R7358:Greb1 UTSW 12 16,774,882 (GRCm39) missense probably damaging 1.00
R7395:Greb1 UTSW 12 16,759,431 (GRCm39) critical splice donor site probably null
R7526:Greb1 UTSW 12 16,766,766 (GRCm39) missense probably benign 0.00
R7530:Greb1 UTSW 12 16,767,207 (GRCm39) missense probably benign 0.02
R7536:Greb1 UTSW 12 16,732,186 (GRCm39) missense probably damaging 1.00
R7643:Greb1 UTSW 12 16,761,997 (GRCm39) missense probably damaging 0.99
R7732:Greb1 UTSW 12 16,723,864 (GRCm39) missense probably damaging 1.00
R7740:Greb1 UTSW 12 16,790,122 (GRCm39) start gained probably benign
R7747:Greb1 UTSW 12 16,724,796 (GRCm39) missense probably benign 0.01
R7760:Greb1 UTSW 12 16,773,417 (GRCm39) missense probably benign
R7937:Greb1 UTSW 12 16,766,670 (GRCm39) missense probably damaging 0.99
R8043:Greb1 UTSW 12 16,761,790 (GRCm39) missense probably damaging 1.00
R8259:Greb1 UTSW 12 16,774,925 (GRCm39) nonsense probably null
R8553:Greb1 UTSW 12 16,773,328 (GRCm39) missense probably benign 0.00
R8559:Greb1 UTSW 12 16,746,436 (GRCm39) missense probably damaging 1.00
R8690:Greb1 UTSW 12 16,746,548 (GRCm39) missense probably benign 0.03
R8830:Greb1 UTSW 12 16,738,520 (GRCm39) missense probably benign 0.35
R8911:Greb1 UTSW 12 16,740,903 (GRCm39) missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16,774,885 (GRCm39) missense probably damaging 1.00
R8986:Greb1 UTSW 12 16,734,457 (GRCm39) missense probably damaging 0.99
R9013:Greb1 UTSW 12 16,789,970 (GRCm39) missense probably damaging 1.00
R9279:Greb1 UTSW 12 16,732,153 (GRCm39) missense probably damaging 0.99
R9360:Greb1 UTSW 12 16,790,037 (GRCm39) missense probably damaging 1.00
R9563:Greb1 UTSW 12 16,774,824 (GRCm39) missense probably benign 0.06
R9616:Greb1 UTSW 12 16,790,038 (GRCm39) missense probably damaging 1.00
R9627:Greb1 UTSW 12 16,756,167 (GRCm39) missense probably damaging 1.00
R9731:Greb1 UTSW 12 16,738,598 (GRCm39) missense probably damaging 1.00
R9761:Greb1 UTSW 12 16,751,275 (GRCm39) missense probably benign 0.05
Z1176:Greb1 UTSW 12 16,746,757 (GRCm39) missense probably benign 0.00
Z1177:Greb1 UTSW 12 16,752,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTGGGCAGAACCACTATTCC -3'
(R):5'- ACACATTGAGGCGTCCCCTAACATC -3'

Sequencing Primer
(F):5'- agttctcatctctctgtgtttcc -3'
(R):5'- ATCACACACTATGCCCTGCTC -3'
Posted On 2013-08-06