Incidental Mutation 'R8311:Gpr158'
ID641360
Institutional Source Beutler Lab
Gene Symbol Gpr158
Ensembl Gene ENSMUSG00000045967
Gene NameG protein-coupled receptor 158
Synonyms5330427M13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8311 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location21367542-21830547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21368890 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 212 (H212R)
Ref Sequence ENSEMBL: ENSMUSP00000049708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055946]
Predicted Effect probably benign
Transcript: ENSMUST00000055946
AA Change: H212R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: H212R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 110 125 N/A INTRINSIC
SCOP:d1edmb_ 313 359 5e-4 SMART
Blast:EGF 318 365 2e-27 BLAST
Pfam:7tm_3 426 669 1.2e-35 PFAM
low complexity region 840 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,973,169 V834A probably benign Het
4930407I10Rik T C 15: 82,063,239 W446R possibly damaging Het
Aldh1l2 T A 10: 83,490,615 E912D probably damaging Het
Apol9a T C 15: 77,405,020 D49G possibly damaging Het
Bnc2 A T 4: 84,276,345 D847E possibly damaging Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Copb2 G T 9: 98,568,019 K10N possibly damaging Het
Cyp4a14 A G 4: 115,491,078 S401P probably damaging Het
Cyp4f15 A T 17: 32,697,940 Q277L probably benign Het
Dmxl2 A T 9: 54,446,933 S410T probably benign Het
Dnah9 T C 11: 65,989,818 N2651S probably benign Het
Efhb A G 17: 53,413,461 probably null Het
Eif4ebp1 T A 8: 27,275,096 F113L probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Eng A G 2: 32,678,993 T511A probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam120a T C 13: 48,933,957 H309R possibly damaging Het
Gga3 A T 11: 115,587,008 S585T probably benign Het
Gm12117 T C 11: 33,276,126 Q70R probably damaging Het
Gm15922 T C 7: 3,736,483 D462G probably benign Het
Hmgb1 A G 5: 149,050,617 F41L possibly damaging Het
Itgav T A 2: 83,765,777 I214N probably damaging Het
Kcna1 T A 6: 126,642,292 H355L probably benign Het
Lrrc37a C T 11: 103,503,421 V393I probably benign Het
Mak16 T C 8: 31,168,669 D4G probably damaging Het
Metap2 C T 10: 93,861,522 R432H possibly damaging Het
Nlrc4 G A 17: 74,446,545 T281M probably damaging Het
Ntrk1 T A 3: 87,781,563 Q561L probably damaging Het
Olfr1328 A C 4: 118,934,150 S231A probably damaging Het
Olfr1493-ps1 A G 19: 13,726,671 T137A possibly damaging Het
Polr2a T C 11: 69,737,456 I1304V probably null Het
Ppp4r2 T C 6: 100,866,382 S354P probably benign Het
Ptchd3 A G 11: 121,836,473 H391R possibly damaging Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rmdn1 T C 4: 19,575,329 probably null Het
Rp1 T A 1: 4,348,349 I847L probably benign Het
Rtn1 T C 12: 72,304,064 E457G probably damaging Het
Serpind1 G A 16: 17,342,866 S420N possibly damaging Het
Sirpa T C 2: 129,616,223 V253A probably damaging Het
Snapc4 A T 2: 26,378,534 F38L probably benign Het
Srcap T C 7: 127,557,797 F2321S probably damaging Het
Stat4 A T 1: 52,102,916 I641F probably damaging Het
Tmem216 A T 19: 10,551,827 F65Y probably benign Het
Tmem37 C T 1: 120,068,252 V32M possibly damaging Het
Tmprss11c T G 5: 86,235,553 Q338P probably damaging Het
Tonsl C T 15: 76,633,263 S752N probably benign Het
Vmn1r26 T C 6: 58,008,533 K224E probably benign Het
Vps13b T A 15: 35,886,954 V3229D probably benign Het
Vwa5b2 C T 16: 20,591,222 R21W probably damaging Het
Wdr37 T C 13: 8,853,573 R165G unknown Het
Yars2 T C 16: 16,307,283 F388L probably benign Het
Ykt6 T A 11: 5,962,366 D106E probably benign Het
Zc3h12a A C 4: 125,126,995 S18R possibly damaging Het
Other mutations in Gpr158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Gpr158 APN 2 21368683 missense probably damaging 1.00
IGL00469:Gpr158 APN 2 21746795 splice site probably benign
IGL00706:Gpr158 APN 2 21746773 missense probably damaging 1.00
IGL00780:Gpr158 APN 2 21826818 nonsense probably null
IGL00885:Gpr158 APN 2 21649021 missense probably damaging 1.00
IGL01339:Gpr158 APN 2 21369031 missense possibly damaging 0.73
IGL01368:Gpr158 APN 2 21827098 missense probably damaging 1.00
IGL02141:Gpr158 APN 2 21783290 missense probably damaging 0.99
IGL02455:Gpr158 APN 2 21368700 missense probably benign 0.00
IGL02554:Gpr158 APN 2 21826596 missense probably benign
IGL02681:Gpr158 APN 2 21815630 missense probably damaging 1.00
IGL02752:Gpr158 APN 2 21826827 missense possibly damaging 0.95
IGL02756:Gpr158 APN 2 21827079 missense possibly damaging 0.47
IGL03181:Gpr158 APN 2 21783161 missense probably benign 0.02
IGL03258:Gpr158 APN 2 21825274 missense probably damaging 1.00
IGL03386:Gpr158 APN 2 21826246 missense probably damaging 1.00
PIT4810001:Gpr158 UTSW 2 21826871 missense probably benign 0.01
R0071:Gpr158 UTSW 2 21810668 missense probably benign 0.08
R0081:Gpr158 UTSW 2 21826717 missense probably damaging 1.00
R0528:Gpr158 UTSW 2 21825208 missense probably damaging 1.00
R0560:Gpr158 UTSW 2 21825274 missense probably damaging 1.00
R0603:Gpr158 UTSW 2 21815669 missense possibly damaging 0.67
R1560:Gpr158 UTSW 2 21826314 missense probably damaging 1.00
R1561:Gpr158 UTSW 2 21815694 splice site probably null
R1609:Gpr158 UTSW 2 21783293 missense possibly damaging 0.61
R1741:Gpr158 UTSW 2 21827548 missense probably benign 0.00
R1827:Gpr158 UTSW 2 21827318 missense probably benign
R1854:Gpr158 UTSW 2 21369124 missense probably damaging 1.00
R1871:Gpr158 UTSW 2 21815615 missense probably damaging 1.00
R2151:Gpr158 UTSW 2 21827514 missense possibly damaging 0.82
R2273:Gpr158 UTSW 2 21826863 missense probably benign
R2275:Gpr158 UTSW 2 21826863 missense probably benign
R3004:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R3151:Gpr158 UTSW 2 21576960 missense possibly damaging 0.68
R3943:Gpr158 UTSW 2 21368559 missense possibly damaging 0.65
R4238:Gpr158 UTSW 2 21368551 missense probably damaging 1.00
R4379:Gpr158 UTSW 2 21825214 missense probably damaging 1.00
R4381:Gpr158 UTSW 2 21827592 missense probably damaging 1.00
R4464:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4467:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4496:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4506:Gpr158 UTSW 2 21826999 missense probably damaging 0.99
R4530:Gpr158 UTSW 2 21369000 missense probably benign 0.03
R4646:Gpr158 UTSW 2 21827053 missense probably benign
R4798:Gpr158 UTSW 2 21783182 missense probably damaging 1.00
R4882:Gpr158 UTSW 2 21825248 missense probably damaging 0.98
R4943:Gpr158 UTSW 2 21827157 missense probably damaging 1.00
R5334:Gpr158 UTSW 2 21827505 missense probably benign 0.01
R5560:Gpr158 UTSW 2 21826290 missense possibly damaging 0.67
R5600:Gpr158 UTSW 2 21827235 missense probably benign
R5637:Gpr158 UTSW 2 21783272 missense probably benign 0.00
R5701:Gpr158 UTSW 2 21746709 missense probably damaging 1.00
R5744:Gpr158 UTSW 2 21368520 missense probably damaging 1.00
R5911:Gpr158 UTSW 2 21369121 missense possibly damaging 0.95
R5991:Gpr158 UTSW 2 21368508 missense probably damaging 0.99
R6200:Gpr158 UTSW 2 21399416 missense probably damaging 0.97
R6306:Gpr158 UTSW 2 21815611 missense possibly damaging 0.84
R6324:Gpr158 UTSW 2 21810554 missense probably damaging 1.00
R6384:Gpr158 UTSW 2 21826288 missense probably damaging 1.00
R6698:Gpr158 UTSW 2 21827110 missense probably damaging 1.00
R6997:Gpr158 UTSW 2 21648991 missense possibly damaging 0.46
R7086:Gpr158 UTSW 2 21826575 missense probably benign 0.01
R7175:Gpr158 UTSW 2 21368302 missense probably benign 0.13
R7197:Gpr158 UTSW 2 21810601 missense probably damaging 0.99
R7293:Gpr158 UTSW 2 21576939 missense possibly damaging 0.47
R7427:Gpr158 UTSW 2 21827318 missense probably benign
R7515:Gpr158 UTSW 2 21368281 missense probably damaging 1.00
R7730:Gpr158 UTSW 2 21826347 missense probably damaging 1.00
R8122:Gpr158 UTSW 2 21826863 missense probably benign
X0062:Gpr158 UTSW 2 21826369 missense probably damaging 1.00
Z1176:Gpr158 UTSW 2 21810690 critical splice donor site probably null
Z1177:Gpr158 UTSW 2 21827272 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GCAATAAGTCTCGGGAACAGAC -3'
(R):5'- CCATTCTCGCACTCCAGATAAGG -3'

Sequencing Primer
(F):5'- GATGACCTGCAGTGGTACCAG -3'
(R):5'- CACTTGACGTGGCTCCT -3'
Posted On2020-07-28