Incidental Mutation 'R8311:Snapc4'
ID641361
Institutional Source Beutler Lab
Gene Symbol Snapc4
Ensembl Gene ENSMUSG00000036281
Gene Namesmall nuclear RNA activating complex, polypeptide 4
Synonyms5730436L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8311 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26362765-26380653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26378534 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 38 (F38L)
Ref Sequence ENSEMBL: ENSMUSP00000109750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028293] [ENSMUST00000035427] [ENSMUST00000077983] [ENSMUST00000114100] [ENSMUST00000114102] [ENSMUST00000114115]
Predicted Effect probably benign
Transcript: ENSMUST00000028293
SMART Domains Protein: ENSMUSP00000028293
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 209 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035427
AA Change: F30L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281
AA Change: F30L

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077983
SMART Domains Protein: ENSMUSP00000077133
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 186 298 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114100
SMART Domains Protein: ENSMUSP00000109735
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 236 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114102
SMART Domains Protein: ENSMUSP00000109737
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 259 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114115
AA Change: F38L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281
AA Change: F38L

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123934
SMART Domains Protein: ENSMUSP00000122456
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
SANT 47 99 3.05e-9 SMART
SANT 102 151 8.24e-15 SMART
SANT 154 203 7.8e-16 SMART
low complexity region 218 249 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of the small nuclear RNA-activating protein (SNAP) complex. The encoded protein contains a Myb DNA-binding domain, and is essential for RNA polymerase II and III polymerase transcription from small nuclear RNA promoters. A mutation in this gene is associated with ankylosing spondylitis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007B14Rik T A 8: 75,753,490 probably benign Het
1700022I11Rik T C 4: 42,973,169 V834A probably benign Het
2700049A03Rik A G 12: 71,138,041 probably benign Het
4930407I10Rik T C 15: 82,063,239 W446R possibly damaging Het
Aldh1l2 T A 10: 83,490,615 E912D probably damaging Het
Apol9a T C 15: 77,405,020 D49G possibly damaging Het
Bnc2 A T 4: 84,276,345 D847E possibly damaging Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Copb2 G T 9: 98,568,019 K10N possibly damaging Het
Cyp4a14 A G 4: 115,491,078 S401P probably damaging Het
Cyp4f15 A T 17: 32,697,940 Q277L probably benign Het
Dmxl2 A T 9: 54,446,933 S410T probably benign Het
Dnah9 T C 11: 65,989,818 N2651S probably benign Het
Efhb A G 17: 53,413,461 probably null Het
Eif4ebp1 T A 8: 27,275,096 F113L probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Eng A G 2: 32,678,993 T511A probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam120a T C 13: 48,933,957 H309R possibly damaging Het
Gga3 A T 11: 115,587,008 S585T probably benign Het
Gm12117 T C 11: 33,276,126 Q70R probably damaging Het
Gm15922 T C 7: 3,736,483 D462G probably benign Het
Gpr158 A G 2: 21,368,890 H212R probably benign Het
Hmgb1 A G 5: 149,050,617 F41L possibly damaging Het
Itgav T A 2: 83,765,777 I214N probably damaging Het
Kcna1 T A 6: 126,642,292 H355L probably benign Het
Lrrc37a C T 11: 103,503,421 V393I probably benign Het
Mak16 T C 8: 31,168,669 D4G probably damaging Het
Metap2 C T 10: 93,861,522 R432H possibly damaging Het
Nlrc4 G A 17: 74,446,545 T281M probably damaging Het
Ntrk1 T A 3: 87,781,563 Q561L probably damaging Het
Olfr1328 A C 4: 118,934,150 S231A probably damaging Het
Olfr1493-ps1 A G 19: 13,726,671 T137A possibly damaging Het
Polr2a T C 11: 69,737,456 I1304V probably null Het
Ppp4r2 T C 6: 100,866,382 S354P probably benign Het
Ptchd3 A G 11: 121,836,473 H391R possibly damaging Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rmdn1 T C 4: 19,575,329 probably null Het
Rp1 T A 1: 4,348,349 I847L probably benign Het
Rtn1 T C 12: 72,304,064 E457G probably damaging Het
Serpind1 G A 16: 17,342,866 S420N possibly damaging Het
Sirpa T C 2: 129,616,223 V253A probably damaging Het
Srcap T C 7: 127,557,797 F2321S probably damaging Het
Stat4 A T 1: 52,102,916 I641F probably damaging Het
Tmem216 A T 19: 10,551,827 F65Y probably benign Het
Tmem37 C T 1: 120,068,252 V32M possibly damaging Het
Tmprss11c T G 5: 86,235,553 Q338P probably damaging Het
Tonsl C T 15: 76,633,263 S752N probably benign Het
Vmn1r26 T C 6: 58,008,533 K224E probably benign Het
Vps13b T A 15: 35,886,954 V3229D probably benign Het
Vwa5b2 C T 16: 20,591,222 R21W probably damaging Het
Wdr37 T C 13: 8,853,573 R165G unknown Het
Yars2 T C 16: 16,307,283 F388L probably benign Het
Ykt6 T A 11: 5,962,366 D106E probably benign Het
Zc3h12a A C 4: 125,126,995 S18R possibly damaging Het
Other mutations in Snapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Snapc4 APN 2 26369312 missense probably benign
IGL01730:Snapc4 APN 2 26363724 splice site probably null
IGL01958:Snapc4 APN 2 26366440 unclassified probably benign
IGL02354:Snapc4 APN 2 26367307 unclassified probably benign
IGL02425:Snapc4 APN 2 26368200 missense probably damaging 1.00
IGL02812:Snapc4 APN 2 26369372 missense probably benign 0.03
IGL02951:Snapc4 APN 2 26370835 missense probably benign 0.33
R0011:Snapc4 UTSW 2 26364813 missense probably benign 0.03
R0409:Snapc4 UTSW 2 26367216 missense probably benign 0.37
R0932:Snapc4 UTSW 2 26374646 missense probably damaging 1.00
R1674:Snapc4 UTSW 2 26376197 missense probably benign
R1878:Snapc4 UTSW 2 26376153 critical splice donor site probably null
R3722:Snapc4 UTSW 2 26365428 missense probably benign
R3886:Snapc4 UTSW 2 26365498 nonsense probably null
R3887:Snapc4 UTSW 2 26365498 nonsense probably null
R3888:Snapc4 UTSW 2 26365498 nonsense probably null
R3889:Snapc4 UTSW 2 26365498 nonsense probably null
R4638:Snapc4 UTSW 2 26365302 missense probably damaging 1.00
R4663:Snapc4 UTSW 2 26374181 missense possibly damaging 0.77
R4879:Snapc4 UTSW 2 26365992 missense possibly damaging 0.93
R4922:Snapc4 UTSW 2 26369233 missense probably benign
R5385:Snapc4 UTSW 2 26374503 missense probably benign 0.44
R5525:Snapc4 UTSW 2 26369526 small deletion probably benign
R5762:Snapc4 UTSW 2 26378606 missense probably damaging 1.00
R5839:Snapc4 UTSW 2 26365534 missense probably benign 0.01
R6300:Snapc4 UTSW 2 26378551 missense probably benign 0.14
R6422:Snapc4 UTSW 2 26368303 missense probably benign 0.00
R6843:Snapc4 UTSW 2 26373599 missense probably benign 0.03
R7044:Snapc4 UTSW 2 26369953 missense probably damaging 1.00
R7341:Snapc4 UTSW 2 26369261 missense probably benign 0.01
R7727:Snapc4 UTSW 2 26373434 missense probably damaging 1.00
R7941:Snapc4 UTSW 2 26376718 missense probably damaging 0.98
R8277:Snapc4 UTSW 2 26365710 missense probably benign 0.05
R8323:Snapc4 UTSW 2 26364699 missense probably benign 0.15
X0010:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0011:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0014:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0017:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0021:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0023:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0028:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0033:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0064:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0067:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
Z1176:Snapc4 UTSW 2 26368222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGACAGCTAAGACTAAG -3'
(R):5'- GTCTGCATTTGAACAGGCTC -3'

Sequencing Primer
(F):5'- CTGAAACAAACTTTCTTACTGAGGTG -3'
(R):5'- TTGCCACCTCCAGCAAGTG -3'
Posted On2020-07-28