Incidental Mutation 'R8311:Itgav'
ID641363
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8311 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83765777 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 214 (I214N)
Ref Sequence ENSEMBL: ENSMUSP00000028499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]
Predicted Effect probably damaging
Transcript: ENSMUST00000028499
AA Change: I214N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: I214N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111740
AA Change: I178N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: I178N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,973,169 V834A probably benign Het
4930407I10Rik T C 15: 82,063,239 W446R possibly damaging Het
Aldh1l2 T A 10: 83,490,615 E912D probably damaging Het
Apol9a T C 15: 77,405,020 D49G possibly damaging Het
Bnc2 A T 4: 84,276,345 D847E possibly damaging Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Copb2 G T 9: 98,568,019 K10N possibly damaging Het
Cyp4a14 A G 4: 115,491,078 S401P probably damaging Het
Cyp4f15 A T 17: 32,697,940 Q277L probably benign Het
Dmxl2 A T 9: 54,446,933 S410T probably benign Het
Dnah9 T C 11: 65,989,818 N2651S probably benign Het
Efhb A G 17: 53,413,461 probably null Het
Eif4ebp1 T A 8: 27,275,096 F113L probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Eng A G 2: 32,678,993 T511A probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam120a T C 13: 48,933,957 H309R possibly damaging Het
Gga3 A T 11: 115,587,008 S585T probably benign Het
Gm12117 T C 11: 33,276,126 Q70R probably damaging Het
Gm15922 T C 7: 3,736,483 D462G probably benign Het
Gpr158 A G 2: 21,368,890 H212R probably benign Het
Hmgb1 A G 5: 149,050,617 F41L possibly damaging Het
Kcna1 T A 6: 126,642,292 H355L probably benign Het
Lrrc37a C T 11: 103,503,421 V393I probably benign Het
Mak16 T C 8: 31,168,669 D4G probably damaging Het
Metap2 C T 10: 93,861,522 R432H possibly damaging Het
Nlrc4 G A 17: 74,446,545 T281M probably damaging Het
Ntrk1 T A 3: 87,781,563 Q561L probably damaging Het
Olfr1328 A C 4: 118,934,150 S231A probably damaging Het
Olfr1493-ps1 A G 19: 13,726,671 T137A possibly damaging Het
Polr2a T C 11: 69,737,456 I1304V probably null Het
Ppp4r2 T C 6: 100,866,382 S354P probably benign Het
Ptchd3 A G 11: 121,836,473 H391R possibly damaging Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rmdn1 T C 4: 19,575,329 probably null Het
Rp1 T A 1: 4,348,349 I847L probably benign Het
Rtn1 T C 12: 72,304,064 E457G probably damaging Het
Serpind1 G A 16: 17,342,866 S420N possibly damaging Het
Sirpa T C 2: 129,616,223 V253A probably damaging Het
Snapc4 A T 2: 26,378,534 F38L probably benign Het
Srcap T C 7: 127,557,797 F2321S probably damaging Het
Stat4 A T 1: 52,102,916 I641F probably damaging Het
Tmem216 A T 19: 10,551,827 F65Y probably benign Het
Tmem37 C T 1: 120,068,252 V32M possibly damaging Het
Tmprss11c T G 5: 86,235,553 Q338P probably damaging Het
Tonsl C T 15: 76,633,263 S752N probably benign Het
Vmn1r26 T C 6: 58,008,533 K224E probably benign Het
Vps13b T A 15: 35,886,954 V3229D probably benign Het
Vwa5b2 C T 16: 20,591,222 R21W probably damaging Het
Wdr37 T C 13: 8,853,573 R165G unknown Het
Yars2 T C 16: 16,307,283 F388L probably benign Het
Ykt6 T A 11: 5,962,366 D106E probably benign Het
Zc3h12a A C 4: 125,126,995 S18R possibly damaging Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R0554:Itgav UTSW 2 83794270 missense possibly damaging 0.95
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3766:Itgav UTSW 2 83801885 critical splice donor site probably null
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R3880:Itgav UTSW 2 83768301 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4287:Itgav UTSW 2 83724840 nonsense probably null
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6482:Itgav UTSW 2 83794270 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
R7429:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7430:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7522:Itgav UTSW 2 83802029 missense probably benign 0.10
R7546:Itgav UTSW 2 83776550 nonsense probably null
R7578:Itgav UTSW 2 83747875 missense probably benign 0.16
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGTTGTTAAGAGTTACTTGAGACTGAC -3'
(R):5'- TCAAAGCTATCTGCCTCTTTGACG -3'

Sequencing Primer
(F):5'- TCTAGCCAGGATCTGTAGGAACC -3'
(R):5'- GTATATGCAAAATTACAGAGCAACC -3'
Posted On2020-07-28