Incidental Mutation 'R8311:Cyp4a14'
ID 641369
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 067796-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8311 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115348275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 401 (S401P)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: S401P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: S401P

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,184,815 (GRCm39) probably benign Het
4930407I10Rik T C 15: 81,947,440 (GRCm39) W446R possibly damaging Het
Aldh1l2 T A 10: 83,326,479 (GRCm39) E912D probably damaging Het
Apol9a T C 15: 77,289,220 (GRCm39) D49G possibly damaging Het
Bnc2 A T 4: 84,194,582 (GRCm39) D847E possibly damaging Het
Ccdc91 A G 6: 147,437,114 (GRCm39) N100S possibly damaging Het
Copb2 G T 9: 98,450,072 (GRCm39) K10N possibly damaging Het
Cyp4f15 A T 17: 32,916,914 (GRCm39) Q277L probably benign Het
Dmxl2 A T 9: 54,354,217 (GRCm39) S410T probably benign Het
Dnah9 T C 11: 65,880,644 (GRCm39) N2651S probably benign Het
Efhb A G 17: 53,720,489 (GRCm39) probably null Het
Eif4ebp1 T A 8: 27,765,124 (GRCm39) F113L probably damaging Het
Emilin2 C G 17: 71,562,141 (GRCm39) D954H probably damaging Het
Eng A G 2: 32,569,005 (GRCm39) T511A probably benign Het
Eps8l1 A G 7: 4,474,817 (GRCm39) D266G probably damaging Het
Fam120a T C 13: 49,087,433 (GRCm39) H309R possibly damaging Het
Gga3 A T 11: 115,477,834 (GRCm39) S585T probably benign Het
Gm12117 T C 11: 33,226,126 (GRCm39) Q70R probably damaging Het
Gpr158 A G 2: 21,373,701 (GRCm39) H212R probably benign Het
Hmgb1 A G 5: 148,987,427 (GRCm39) F41L possibly damaging Het
Iqcm T A 8: 76,480,118 (GRCm39) probably benign Het
Itgav T A 2: 83,596,121 (GRCm39) I214N probably damaging Het
Kcna1 T A 6: 126,619,255 (GRCm39) H355L probably benign Het
Lrrc37a C T 11: 103,394,247 (GRCm39) V393I probably benign Het
Mak16 T C 8: 31,658,697 (GRCm39) D4G probably damaging Het
Metap2 C T 10: 93,697,384 (GRCm39) R432H possibly damaging Het
Nlrc4 G A 17: 74,753,540 (GRCm39) T281M probably damaging Het
Ntrk1 T A 3: 87,688,870 (GRCm39) Q561L probably damaging Het
Or10ak7 A C 4: 118,791,347 (GRCm39) S231A probably damaging Het
Or10w3 A G 19: 13,704,035 (GRCm39) T137A possibly damaging Het
Pira1 T C 7: 3,739,482 (GRCm39) D462G probably benign Het
Polr2a T C 11: 69,628,282 (GRCm39) I1304V probably null Het
Ppp4r2 T C 6: 100,843,343 (GRCm39) S354P probably benign Het
Ptchd3 A G 11: 121,727,299 (GRCm39) H391R possibly damaging Het
Rchy1 T C 5: 92,099,762 (GRCm39) D192G probably damaging Het
Rmdn1 T C 4: 19,575,329 (GRCm39) probably null Het
Rp1 T A 1: 4,418,572 (GRCm39) I847L probably benign Het
Rtn1 T C 12: 72,350,838 (GRCm39) E457G probably damaging Het
Serpind1 G A 16: 17,160,730 (GRCm39) S420N possibly damaging Het
Sirpa T C 2: 129,458,143 (GRCm39) V253A probably damaging Het
Snapc4 A T 2: 26,268,546 (GRCm39) F38L probably benign Het
Spata31g1 T C 4: 42,973,169 (GRCm39) V834A probably benign Het
Srcap T C 7: 127,156,969 (GRCm39) F2321S probably damaging Het
Stat4 A T 1: 52,142,075 (GRCm39) I641F probably damaging Het
Tmem216 A T 19: 10,529,191 (GRCm39) F65Y probably benign Het
Tmem37 C T 1: 119,995,982 (GRCm39) V32M possibly damaging Het
Tmprss11c T G 5: 86,383,412 (GRCm39) Q338P probably damaging Het
Tonsl C T 15: 76,517,463 (GRCm39) S752N probably benign Het
Vmn1r26 T C 6: 57,985,518 (GRCm39) K224E probably benign Het
Vps13b T A 15: 35,887,100 (GRCm39) V3229D probably benign Het
Vwa5b2 C T 16: 20,409,972 (GRCm39) R21W probably damaging Het
Wdr37 T C 13: 8,903,609 (GRCm39) R165G unknown Het
Yars2 T C 16: 16,125,147 (GRCm39) F388L probably benign Het
Ykt6 T A 11: 5,912,366 (GRCm39) D106E probably benign Het
Zc3h12a A C 4: 125,020,788 (GRCm39) S18R possibly damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CGTGACTGCAATTTCAAGTCTG -3'
(R):5'- CCTCTGTCACATGGTAAGAACC -3'

Sequencing Primer
(F):5'- CCTCTGCTATATAGGCAGCTGAAG -3'
(R):5'- CACTTGTCTTTTTATAGGAGAGACC -3'
Posted On 2020-07-28