Incidental Mutation 'R8311:Rchy1'
ID641373
Institutional Source Beutler Lab
Gene Symbol Rchy1
Ensembl Gene ENSMUSG00000029397
Gene Namering finger and CHY zinc finger domain containing 1
SynonymsZfp363, Pirh2, 6720407C15Rik, PRO1996
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R8311 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location91948904-91963068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91951903 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 192 (D192G)
Ref Sequence ENSEMBL: ENSMUSP00000031345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031345] [ENSMUST00000169948]
PDB Structure
Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000031345
AA Change: D192G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031345
Gene: ENSMUSG00000029397
AA Change: D192G

DomainStartEndE-ValueType
Pfam:zf-CHY 20 93 2.2e-24 PFAM
low complexity region 119 130 N/A INTRINSIC
RING 145 186 1.38e-7 SMART
Pfam:zinc_ribbon_6 191 249 6.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140670
Predicted Effect probably damaging
Transcript: ENSMUST00000169948
AA Change: D152G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131270
Gene: ENSMUSG00000029397
AA Change: D152G

DomainStartEndE-ValueType
PDB:2DKT|A 10 99 2e-41 PDB
RING 105 146 1.38e-7 SMART
Pfam:zinc_ribbon_6 150 210 3.1e-33 PFAM
Meta Mutation Damage Score 0.6575 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a knock-out allele exhibit decreased cellular sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,973,169 V834A probably benign Het
4930407I10Rik T C 15: 82,063,239 W446R possibly damaging Het
Aldh1l2 T A 10: 83,490,615 E912D probably damaging Het
Apol9a T C 15: 77,405,020 D49G possibly damaging Het
Bnc2 A T 4: 84,276,345 D847E possibly damaging Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Copb2 G T 9: 98,568,019 K10N possibly damaging Het
Cyp4a14 A G 4: 115,491,078 S401P probably damaging Het
Cyp4f15 A T 17: 32,697,940 Q277L probably benign Het
Dmxl2 A T 9: 54,446,933 S410T probably benign Het
Dnah9 T C 11: 65,989,818 N2651S probably benign Het
Efhb A G 17: 53,413,461 probably null Het
Eif4ebp1 T A 8: 27,275,096 F113L probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Eng A G 2: 32,678,993 T511A probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam120a T C 13: 48,933,957 H309R possibly damaging Het
Gga3 A T 11: 115,587,008 S585T probably benign Het
Gm12117 T C 11: 33,276,126 Q70R probably damaging Het
Gm15922 T C 7: 3,736,483 D462G probably benign Het
Gpr158 A G 2: 21,368,890 H212R probably benign Het
Hmgb1 A G 5: 149,050,617 F41L possibly damaging Het
Itgav T A 2: 83,765,777 I214N probably damaging Het
Kcna1 T A 6: 126,642,292 H355L probably benign Het
Lrrc37a C T 11: 103,503,421 V393I probably benign Het
Mak16 T C 8: 31,168,669 D4G probably damaging Het
Metap2 C T 10: 93,861,522 R432H possibly damaging Het
Nlrc4 G A 17: 74,446,545 T281M probably damaging Het
Ntrk1 T A 3: 87,781,563 Q561L probably damaging Het
Olfr1328 A C 4: 118,934,150 S231A probably damaging Het
Olfr1493-ps1 A G 19: 13,726,671 T137A possibly damaging Het
Polr2a T C 11: 69,737,456 I1304V probably null Het
Ppp4r2 T C 6: 100,866,382 S354P probably benign Het
Ptchd3 A G 11: 121,836,473 H391R possibly damaging Het
Rmdn1 T C 4: 19,575,329 probably null Het
Rp1 T A 1: 4,348,349 I847L probably benign Het
Rtn1 T C 12: 72,304,064 E457G probably damaging Het
Serpind1 G A 16: 17,342,866 S420N possibly damaging Het
Sirpa T C 2: 129,616,223 V253A probably damaging Het
Snapc4 A T 2: 26,378,534 F38L probably benign Het
Srcap T C 7: 127,557,797 F2321S probably damaging Het
Stat4 A T 1: 52,102,916 I641F probably damaging Het
Tmem216 A T 19: 10,551,827 F65Y probably benign Het
Tmem37 C T 1: 120,068,252 V32M possibly damaging Het
Tmprss11c T G 5: 86,235,553 Q338P probably damaging Het
Tonsl C T 15: 76,633,263 S752N probably benign Het
Vmn1r26 T C 6: 58,008,533 K224E probably benign Het
Vps13b T A 15: 35,886,954 V3229D probably benign Het
Vwa5b2 C T 16: 20,591,222 R21W probably damaging Het
Wdr37 T C 13: 8,853,573 R165G unknown Het
Yars2 T C 16: 16,307,283 F388L probably benign Het
Ykt6 T A 11: 5,962,366 D106E probably benign Het
Zc3h12a A C 4: 125,126,995 S18R possibly damaging Het
Other mutations in Rchy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Rchy1 APN 5 91957546 nonsense probably null
IGL02668:Rchy1 APN 5 91962718 start codon destroyed probably null 0.43
IGL03251:Rchy1 APN 5 91962643 missense probably benign 0.08
R0137:Rchy1 UTSW 5 91957599 missense probably benign 0.01
R0959:Rchy1 UTSW 5 91957617 missense probably damaging 0.99
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1462:Rchy1 UTSW 5 91957882 missense probably damaging 1.00
R1531:Rchy1 UTSW 5 91955615 critical splice acceptor site probably null
R1868:Rchy1 UTSW 5 91951903 missense probably damaging 0.99
R4350:Rchy1 UTSW 5 91957954 missense probably damaging 1.00
R4953:Rchy1 UTSW 5 91962628 critical splice donor site probably null
R6223:Rchy1 UTSW 5 91957967 missense probably damaging 1.00
R6345:Rchy1 UTSW 5 91957942 missense probably benign 0.08
R6546:Rchy1 UTSW 5 91957958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCACTAGGTCAAAGCAG -3'
(R):5'- CATTTCTTTGCATCAGTGTCCTAAG -3'

Sequencing Primer
(F):5'- CTACTTACGTCAACAGTCAC -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2020-07-28