Incidental Mutation 'R8311:Gm15922'
ID641379
Institutional Source Beutler Lab
Gene Symbol Gm15922
Ensembl Gene ENSMUSG00000081665
Gene Namepredicted gene 15922
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8311 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3733021-3739861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3736483 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 462 (D462G)
Ref Sequence ENSEMBL: ENSMUSP00000145713 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000118068
AA Change: D462G

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007B14Rik T A 8: 75,753,490 probably benign Het
1700022I11Rik T C 4: 42,973,169 V834A probably benign Het
2700049A03Rik A G 12: 71,138,041 probably benign Het
4930407I10Rik T C 15: 82,063,239 W446R possibly damaging Het
Aldh1l2 T A 10: 83,490,615 E912D probably damaging Het
Apol9a T C 15: 77,405,020 D49G possibly damaging Het
Bnc2 A T 4: 84,276,345 D847E possibly damaging Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Copb2 G T 9: 98,568,019 K10N possibly damaging Het
Cyp4a14 A G 4: 115,491,078 S401P probably damaging Het
Cyp4f15 A T 17: 32,697,940 Q277L probably benign Het
Dmxl2 A T 9: 54,446,933 S410T probably benign Het
Dnah9 T C 11: 65,989,818 N2651S probably benign Het
Efhb A G 17: 53,413,461 probably null Het
Eif4ebp1 T A 8: 27,275,096 F113L probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Eng A G 2: 32,678,993 T511A probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam120a T C 13: 48,933,957 H309R possibly damaging Het
Gga3 A T 11: 115,587,008 S585T probably benign Het
Gm12117 T C 11: 33,276,126 Q70R probably damaging Het
Gpr158 A G 2: 21,368,890 H212R probably benign Het
Hmgb1 A G 5: 149,050,617 F41L possibly damaging Het
Itgav T A 2: 83,765,777 I214N probably damaging Het
Kcna1 T A 6: 126,642,292 H355L probably benign Het
Lrrc37a C T 11: 103,503,421 V393I probably benign Het
Mak16 T C 8: 31,168,669 D4G probably damaging Het
Metap2 C T 10: 93,861,522 R432H possibly damaging Het
Nlrc4 G A 17: 74,446,545 T281M probably damaging Het
Ntrk1 T A 3: 87,781,563 Q561L probably damaging Het
Olfr1328 A C 4: 118,934,150 S231A probably damaging Het
Olfr1493-ps1 A G 19: 13,726,671 T137A possibly damaging Het
Polr2a T C 11: 69,737,456 I1304V probably null Het
Ppp4r2 T C 6: 100,866,382 S354P probably benign Het
Ptchd3 A G 11: 121,836,473 H391R possibly damaging Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rmdn1 T C 4: 19,575,329 probably null Het
Rp1 T A 1: 4,348,349 I847L probably benign Het
Rtn1 T C 12: 72,304,064 E457G probably damaging Het
Serpind1 G A 16: 17,342,866 S420N possibly damaging Het
Sirpa T C 2: 129,616,223 V253A probably damaging Het
Snapc4 A T 2: 26,378,534 F38L probably benign Het
Srcap T C 7: 127,557,797 F2321S probably damaging Het
Stat4 A T 1: 52,102,916 I641F probably damaging Het
Tmem216 A T 19: 10,551,827 F65Y probably benign Het
Tmem37 C T 1: 120,068,252 V32M possibly damaging Het
Tmprss11c T G 5: 86,235,553 Q338P probably damaging Het
Tonsl C T 15: 76,633,263 S752N probably benign Het
Vmn1r26 T C 6: 58,008,533 K224E probably benign Het
Vps13b T A 15: 35,886,954 V3229D probably benign Het
Vwa5b2 C T 16: 20,591,222 R21W probably damaging Het
Wdr37 T C 13: 8,853,573 R165G unknown Het
Yars2 T C 16: 16,307,283 F388L probably benign Het
Ykt6 T A 11: 5,962,366 D106E probably benign Het
Zc3h12a A C 4: 125,126,995 S18R possibly damaging Het
Other mutations in Gm15922
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1514:Gm15922 UTSW 7 3739640 missense possibly damaging 0.82
R3902:Gm15922 UTSW 7 3737277 missense probably damaging 0.99
R4246:Gm15922 UTSW 7 3737349 missense probably damaging 1.00
R5125:Gm15922 UTSW 7 3739397 nonsense probably null
R5178:Gm15922 UTSW 7 3739397 nonsense probably null
R5388:Gm15922 UTSW 7 3738857 missense possibly damaging 0.49
R5471:Gm15922 UTSW 7 3735515 missense probably benign 0.02
R5985:Gm15922 UTSW 7 3737317 missense probably damaging 1.00
R6248:Gm15922 UTSW 7 3736338 missense probably benign
R6360:Gm15922 UTSW 7 3736504 missense probably damaging 1.00
R6451:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6453:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6454:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6455:Gm15922 UTSW 7 3738931 missense probably benign 0.00
R6594:Gm15922 UTSW 7 3736499 nonsense probably null
R6654:Gm15922 UTSW 7 3735929 missense probably benign 0.19
R6813:Gm15922 UTSW 7 3736003 missense probably benign 0.03
R6972:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R6975:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7069:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7072:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7188:Gm15922 UTSW 7 3738829 missense probably damaging 0.99
R7304:Gm15922 UTSW 7 3737494 missense probably damaging 1.00
R7329:Gm15922 UTSW 7 3739876 start gained probably benign
R7404:Gm15922 UTSW 7 3739345 missense probably damaging 1.00
R7454:Gm15922 UTSW 7 3735510 missense probably benign 0.03
R7493:Gm15922 UTSW 7 3739024 missense not run
R7655:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7656:Gm15922 UTSW 7 3739282 missense probably damaging 0.98
R7953:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7956:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R7957:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8037:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8038:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8043:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8096:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8117:Gm15922 UTSW 7 3737076 missense probably damaging 1.00
R8128:Gm15922 UTSW 7 3737320 missense probably damaging 1.00
R8134:Gm15922 UTSW 7 3735839 missense probably damaging 0.99
R8142:Gm15922 UTSW 7 3736843 missense possibly damaging 0.88
R8511:Gm15922 UTSW 7 3739348 missense probably damaging 1.00
R8519:Gm15922 UTSW 7 3737433 missense probably benign 0.27
R8928:Gm15922 UTSW 7 3739359 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGATCAGGATGTCCAGG -3'
(R):5'- TTCTCGAACACTGCCCTGAC -3'

Sequencing Primer
(F):5'- ATCAGGATGTCCAGGGGCTC -3'
(R):5'- AGGTGTTTGGTAAGAATAAAACCTC -3'
Posted On2020-07-28