Incidental Mutation 'R8311:Mak16'
ID641383
Institutional Source Beutler Lab
Gene Symbol Mak16
Ensembl Gene ENSMUSG00000031578
Gene NameMAK16 homolog
Synonyms2600016B03Rik, Rbm13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8311 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location31159463-31168764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31168669 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 4 (D4G)
Ref Sequence ENSEMBL: ENSMUSP00000033983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033983] [ENSMUST00000098842] [ENSMUST00000210129]
Predicted Effect probably damaging
Transcript: ENSMUST00000033983
AA Change: D4G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033983
Gene: ENSMUSG00000031578
AA Change: D4G

DomainStartEndE-ValueType
Pfam:Ribosomal_L28e 6 119 5e-40 PFAM
Pfam:Mak16 138 235 4.7e-36 PFAM
low complexity region 242 256 N/A INTRINSIC
low complexity region 258 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098842
SMART Domains Protein: ENSMUSP00000096441
Gene: ENSMUSG00000031577

DomainStartEndE-ValueType
Pfam:DUF2454 208 397 7.1e-17 PFAM
low complexity region 426 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210129
Meta Mutation Damage Score 0.7287 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007B14Rik T A 8: 75,753,490 probably benign Het
1700022I11Rik T C 4: 42,973,169 V834A probably benign Het
2700049A03Rik A G 12: 71,138,041 probably benign Het
4930407I10Rik T C 15: 82,063,239 W446R possibly damaging Het
Aldh1l2 T A 10: 83,490,615 E912D probably damaging Het
Apol9a T C 15: 77,405,020 D49G possibly damaging Het
Bnc2 A T 4: 84,276,345 D847E possibly damaging Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Copb2 G T 9: 98,568,019 K10N possibly damaging Het
Cyp4a14 A G 4: 115,491,078 S401P probably damaging Het
Cyp4f15 A T 17: 32,697,940 Q277L probably benign Het
Dmxl2 A T 9: 54,446,933 S410T probably benign Het
Dnah9 T C 11: 65,989,818 N2651S probably benign Het
Efhb A G 17: 53,413,461 probably null Het
Eif4ebp1 T A 8: 27,275,096 F113L probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Eng A G 2: 32,678,993 T511A probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam120a T C 13: 48,933,957 H309R possibly damaging Het
Gga3 A T 11: 115,587,008 S585T probably benign Het
Gm12117 T C 11: 33,276,126 Q70R probably damaging Het
Gm15922 T C 7: 3,736,483 D462G probably benign Het
Gpr158 A G 2: 21,368,890 H212R probably benign Het
Hmgb1 A G 5: 149,050,617 F41L possibly damaging Het
Itgav T A 2: 83,765,777 I214N probably damaging Het
Kcna1 T A 6: 126,642,292 H355L probably benign Het
Lrrc37a C T 11: 103,503,421 V393I probably benign Het
Metap2 C T 10: 93,861,522 R432H possibly damaging Het
Nlrc4 G A 17: 74,446,545 T281M probably damaging Het
Ntrk1 T A 3: 87,781,563 Q561L probably damaging Het
Olfr1328 A C 4: 118,934,150 S231A probably damaging Het
Olfr1493-ps1 A G 19: 13,726,671 T137A possibly damaging Het
Polr2a T C 11: 69,737,456 I1304V probably null Het
Ppp4r2 T C 6: 100,866,382 S354P probably benign Het
Ptchd3 A G 11: 121,836,473 H391R possibly damaging Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rmdn1 T C 4: 19,575,329 probably null Het
Rp1 T A 1: 4,348,349 I847L probably benign Het
Rtn1 T C 12: 72,304,064 E457G probably damaging Het
Serpind1 G A 16: 17,342,866 S420N possibly damaging Het
Sirpa T C 2: 129,616,223 V253A probably damaging Het
Snapc4 A T 2: 26,378,534 F38L probably benign Het
Srcap T C 7: 127,557,797 F2321S probably damaging Het
Stat4 A T 1: 52,102,916 I641F probably damaging Het
Tmem216 A T 19: 10,551,827 F65Y probably benign Het
Tmem37 C T 1: 120,068,252 V32M possibly damaging Het
Tmprss11c T G 5: 86,235,553 Q338P probably damaging Het
Tonsl C T 15: 76,633,263 S752N probably benign Het
Vmn1r26 T C 6: 58,008,533 K224E probably benign Het
Vps13b T A 15: 35,886,954 V3229D probably benign Het
Vwa5b2 C T 16: 20,591,222 R21W probably damaging Het
Wdr37 T C 13: 8,853,573 R165G unknown Het
Yars2 T C 16: 16,307,283 F388L probably benign Het
Ykt6 T A 11: 5,962,366 D106E probably benign Het
Zc3h12a A C 4: 125,126,995 S18R possibly damaging Het
Other mutations in Mak16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Mak16 APN 8 31166750 missense probably benign
IGL02071:Mak16 APN 8 31160529 missense probably benign 0.00
IGL02457:Mak16 APN 8 31164725 missense possibly damaging 0.83
IGL02486:Mak16 APN 8 31160586 intron probably benign
FR4342:Mak16 UTSW 8 31161749 missense probably benign 0.00
R4527:Mak16 UTSW 8 31166177 nonsense probably null
R4807:Mak16 UTSW 8 31166133 missense probably benign 0.25
R7178:Mak16 UTSW 8 31166574 missense probably benign 0.06
R7315:Mak16 UTSW 8 31164738 nonsense probably null
R7366:Mak16 UTSW 8 31166099 missense possibly damaging 0.88
Z1088:Mak16 UTSW 8 31166095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGGGACTAAGGAAGCCC -3'
(R):5'- AGACGATATGTGCGCTCCTAG -3'

Sequencing Primer
(F):5'- TAAGGAAGCCCACCCGG -3'
(R):5'- GAGCACGCCAGGATCCAAG -3'
Posted On2020-07-28