Incidental Mutation 'R8311:Tonsl'
ID641399
Institutional Source Beutler Lab
Gene Symbol Tonsl
Ensembl Gene ENSMUSG00000059323
Gene Nametonsoku-like, DNA repair protein
SynonymsNfkbil2, 2810439M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8311 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76626002-76639958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76633263 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 752 (S752N)
Ref Sequence ENSEMBL: ENSMUSP00000129597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165190] [ENSMUST00000168185]
Predicted Effect probably benign
Transcript: ENSMUST00000165163
SMART Domains Protein: ENSMUSP00000131229
Gene: ENSMUSG00000059323

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165190
SMART Domains Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 4e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
low complexity region 259 271 N/A INTRINSIC
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168185
AA Change: S752N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: S752N

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 7e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
Pfam:TPR_8 242 274 8.7e-3 PFAM
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
low complexity region 413 437 N/A INTRINSIC
low complexity region 465 494 N/A INTRINSIC
low complexity region 500 511 N/A INTRINSIC
ANK 528 559 8.36e1 SMART
ANK 561 590 4.85e-8 SMART
ANK 597 626 2.85e-5 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
LRR 1058 1085 2.86e-1 SMART
LRR 1086 1113 5.88e-1 SMART
LRR 1117 1144 1.67e-2 SMART
LRR 1177 1204 2.72e0 SMART
LRR 1236 1263 7.02e0 SMART
LRR 1264 1292 1.46e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171478
AA Change: V75I
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,973,169 V834A probably benign Het
4930407I10Rik T C 15: 82,063,239 W446R possibly damaging Het
Aldh1l2 T A 10: 83,490,615 E912D probably damaging Het
Apol9a T C 15: 77,405,020 D49G possibly damaging Het
Bnc2 A T 4: 84,276,345 D847E possibly damaging Het
Ccdc91 A G 6: 147,535,616 N100S possibly damaging Het
Copb2 G T 9: 98,568,019 K10N possibly damaging Het
Cyp4a14 A G 4: 115,491,078 S401P probably damaging Het
Cyp4f15 A T 17: 32,697,940 Q277L probably benign Het
Dmxl2 A T 9: 54,446,933 S410T probably benign Het
Dnah9 T C 11: 65,989,818 N2651S probably benign Het
Efhb A G 17: 53,413,461 probably null Het
Eif4ebp1 T A 8: 27,275,096 F113L probably damaging Het
Emilin2 C G 17: 71,255,146 D954H probably damaging Het
Eng A G 2: 32,678,993 T511A probably benign Het
Eps8l1 A G 7: 4,471,818 D266G probably damaging Het
Fam120a T C 13: 48,933,957 H309R possibly damaging Het
Gga3 A T 11: 115,587,008 S585T probably benign Het
Gm12117 T C 11: 33,276,126 Q70R probably damaging Het
Gm15922 T C 7: 3,736,483 D462G probably benign Het
Gpr158 A G 2: 21,368,890 H212R probably benign Het
Hmgb1 A G 5: 149,050,617 F41L possibly damaging Het
Itgav T A 2: 83,765,777 I214N probably damaging Het
Kcna1 T A 6: 126,642,292 H355L probably benign Het
Lrrc37a C T 11: 103,503,421 V393I probably benign Het
Mak16 T C 8: 31,168,669 D4G probably damaging Het
Metap2 C T 10: 93,861,522 R432H possibly damaging Het
Nlrc4 G A 17: 74,446,545 T281M probably damaging Het
Ntrk1 T A 3: 87,781,563 Q561L probably damaging Het
Olfr1328 A C 4: 118,934,150 S231A probably damaging Het
Olfr1493-ps1 A G 19: 13,726,671 T137A possibly damaging Het
Polr2a T C 11: 69,737,456 I1304V probably null Het
Ppp4r2 T C 6: 100,866,382 S354P probably benign Het
Ptchd3 A G 11: 121,836,473 H391R possibly damaging Het
Rchy1 T C 5: 91,951,903 D192G probably damaging Het
Rmdn1 T C 4: 19,575,329 probably null Het
Rp1 T A 1: 4,348,349 I847L probably benign Het
Rtn1 T C 12: 72,304,064 E457G probably damaging Het
Serpind1 G A 16: 17,342,866 S420N possibly damaging Het
Sirpa T C 2: 129,616,223 V253A probably damaging Het
Snapc4 A T 2: 26,378,534 F38L probably benign Het
Srcap T C 7: 127,557,797 F2321S probably damaging Het
Stat4 A T 1: 52,102,916 I641F probably damaging Het
Tmem216 A T 19: 10,551,827 F65Y probably benign Het
Tmem37 C T 1: 120,068,252 V32M possibly damaging Het
Tmprss11c T G 5: 86,235,553 Q338P probably damaging Het
Vmn1r26 T C 6: 58,008,533 K224E probably benign Het
Vps13b T A 15: 35,886,954 V3229D probably benign Het
Vwa5b2 C T 16: 20,591,222 R21W probably damaging Het
Wdr37 T C 13: 8,853,573 R165G unknown Het
Yars2 T C 16: 16,307,283 F388L probably benign Het
Ykt6 T A 11: 5,962,366 D106E probably benign Het
Zc3h12a A C 4: 125,126,995 S18R possibly damaging Het
Other mutations in Tonsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tonsl APN 15 76638496 missense possibly damaging 0.78
IGL00763:Tonsl APN 15 76633868 missense probably damaging 1.00
IGL00796:Tonsl APN 15 76625149 missense probably benign
IGL00965:Tonsl APN 15 76631880 splice site probably benign
IGL01434:Tonsl APN 15 76631102 missense probably benign 0.11
IGL01859:Tonsl APN 15 76634780 missense probably damaging 0.97
IGL02112:Tonsl APN 15 76633402 missense probably benign 0.01
IGL02189:Tonsl APN 15 76623178 missense possibly damaging 0.56
IGL02281:Tonsl APN 15 76634074 missense probably damaging 1.00
IGL02627:Tonsl APN 15 76634095 missense probably damaging 0.99
IGL02750:Tonsl APN 15 76633389 missense probably damaging 0.97
IGL02977:Tonsl APN 15 76632873 missense probably benign 0.00
R0127:Tonsl UTSW 15 76633485 missense probably benign 0.01
R0316:Tonsl UTSW 15 76629300 missense possibly damaging 0.68
R0443:Tonsl UTSW 15 76639684 missense probably benign
R0714:Tonsl UTSW 15 76633721 splice site probably benign
R0946:Tonsl UTSW 15 76623221 missense probably benign 0.03
R0975:Tonsl UTSW 15 76638932 missense probably damaging 0.99
R1263:Tonsl UTSW 15 76622562 missense possibly damaging 0.85
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1610:Tonsl UTSW 15 76638557 missense probably damaging 1.00
R1623:Tonsl UTSW 15 76638509 missense probably damaging 1.00
R1763:Tonsl UTSW 15 76638066 missense probably damaging 1.00
R1882:Tonsl UTSW 15 76624150 missense possibly damaging 0.83
R1898:Tonsl UTSW 15 76638853 splice site probably null
R1932:Tonsl UTSW 15 76624597 missense probably damaging 0.97
R2141:Tonsl UTSW 15 76632661 missense probably damaging 0.99
R2166:Tonsl UTSW 15 76637313 missense probably benign 0.13
R2191:Tonsl UTSW 15 76632680 missense probably damaging 0.96
R2198:Tonsl UTSW 15 76636672 missense probably benign 0.00
R2219:Tonsl UTSW 15 76634640 missense probably damaging 1.00
R2762:Tonsl UTSW 15 76630620 missense probably damaging 1.00
R3156:Tonsl UTSW 15 76639521 missense probably damaging 1.00
R3508:Tonsl UTSW 15 76639756 missense probably benign
R4012:Tonsl UTSW 15 76637044 missense probably damaging 1.00
R4179:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4180:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4327:Tonsl UTSW 15 76639716 missense probably benign
R4627:Tonsl UTSW 15 76637224 missense probably damaging 1.00
R4671:Tonsl UTSW 15 76623410 missense probably benign 0.01
R4825:Tonsl UTSW 15 76633248 missense probably benign 0.34
R4840:Tonsl UTSW 15 76633209 missense probably benign
R5030:Tonsl UTSW 15 76638101 missense probably damaging 1.00
R5143:Tonsl UTSW 15 76636657 missense possibly damaging 0.80
R6238:Tonsl UTSW 15 76636218 splice site probably null
R6379:Tonsl UTSW 15 76629742 missense probably benign
R6401:Tonsl UTSW 15 76633666 missense probably damaging 1.00
R6534:Tonsl UTSW 15 76629677 missense probably damaging 1.00
R6695:Tonsl UTSW 15 76629818 missense possibly damaging 0.84
R6701:Tonsl UTSW 15 76629300 missense probably damaging 1.00
R7138:Tonsl UTSW 15 76634776 missense probably benign
R7206:Tonsl UTSW 15 76633651 missense probably damaging 1.00
R7287:Tonsl UTSW 15 76633725 splice site probably null
R7615:Tonsl UTSW 15 76630607 missense probably benign 0.44
R7626:Tonsl UTSW 15 76633936 missense probably null 1.00
R7641:Tonsl UTSW 15 76633652 missense probably damaging 1.00
R7920:Tonsl UTSW 15 76634587 missense probably damaging 1.00
Z1177:Tonsl UTSW 15 76636153 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTCCTCCTCGGGAATGAGTG -3'
(R):5'- CCATCTATTTGACCCTGAGACC -3'

Sequencing Primer
(F):5'- CTCCTCGGGAATGAGTGCTGTC -3'
(R):5'- GAGACCTCTCCTCCCTCAAG -3'
Posted On2020-07-28