Incidental Mutation 'R0104:Kcng1'
ID64143
Institutional Source Beutler Lab
Gene Symbol Kcng1
Ensembl Gene ENSMUSG00000074575
Gene Namepotassium voltage-gated channel, subfamily G, member 1
SynonymsOTTMUSG00000016048
MMRRC Submission 038390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0104 (G1)
Quality Score128
Status Not validated
Chromosome2
Chromosomal Location168260117-168281736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 168269046 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 66 (I66T)
Ref Sequence ENSEMBL: ENSMUSP00000104815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099069] [ENSMUST00000109191] [ENSMUST00000131749]
Predicted Effect probably damaging
Transcript: ENSMUST00000099069
AA Change: I66T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096668
Gene: ENSMUSG00000074575
AA Change: I66T

DomainStartEndE-ValueType
BTB 63 172 4.22e-5 SMART
low complexity region 174 197 N/A INTRINSIC
Pfam:Ion_trans 226 470 8.6e-41 PFAM
Pfam:Ion_trans_2 379 465 7.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109191
AA Change: I66T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104815
Gene: ENSMUSG00000074575
AA Change: I66T

DomainStartEndE-ValueType
BTB 63 172 4.22e-5 SMART
low complexity region 174 197 N/A INTRINSIC
Pfam:Ion_trans 270 459 1.9e-31 PFAM
Pfam:Ion_trans_2 379 465 1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131749
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This gene is abundantly expressed in skeletal muscle. Multiple alternatively spliced transcript variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnah5 A T 15: 28,453,353 E4423D possibly damaging Het
Fsip2 A T 2: 82,978,973 T1879S possibly damaging Het
Gm136 G T 4: 34,746,593 H139Q possibly damaging Het
Ifrd2 T A 9: 107,587,917 L10H probably damaging Het
Itpr3 C A 17: 27,095,992 H704Q probably benign Het
Kcnv2 T C 19: 27,323,219 Y157H probably damaging Het
Leng8 A G 7: 4,143,808 D443G probably damaging Het
Mlst8 T C 17: 24,476,117 N264S possibly damaging Het
Pcdhb8 A G 18: 37,355,665 E132G probably benign Het
Pmpcb C G 5: 21,746,038 S266* probably null Het
Prmt7 T C 8: 106,237,350 I292T probably damaging Het
Rif1 T C 2: 52,110,092 L1186S possibly damaging Het
Sox30 A C 11: 45,981,314 E332A possibly damaging Het
Taf2 T C 15: 55,038,338 D820G probably benign Het
Tas2r120 T A 6: 132,657,846 probably null Het
Zfp655 T C 5: 145,244,015 S228P probably damaging Het
Zfyve9 C A 4: 108,718,163 D574Y probably damaging Het
Other mutations in Kcng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Kcng1 APN 2 168268764 missense probably benign
IGL01316:Kcng1 APN 2 168269040 missense probably damaging 1.00
PIT4378001:Kcng1 UTSW 2 168262684 missense probably damaging 0.98
R0692:Kcng1 UTSW 2 168262763 missense probably damaging 0.99
R1574:Kcng1 UTSW 2 168269041 missense probably damaging 1.00
R1574:Kcng1 UTSW 2 168269041 missense probably damaging 1.00
R1591:Kcng1 UTSW 2 168268710 missense possibly damaging 0.76
R1731:Kcng1 UTSW 2 168268689 missense probably benign 0.00
R1937:Kcng1 UTSW 2 168263021 missense probably benign 0.02
R1960:Kcng1 UTSW 2 168262984 missense probably benign 0.03
R2145:Kcng1 UTSW 2 168269032 missense probably damaging 1.00
R4167:Kcng1 UTSW 2 168262697 missense probably damaging 1.00
R5215:Kcng1 UTSW 2 168263133 missense probably benign 0.20
R5816:Kcng1 UTSW 2 168268723 missense possibly damaging 0.90
R6367:Kcng1 UTSW 2 168262652 missense probably damaging 1.00
R7058:Kcng1 UTSW 2 168262609 missense probably damaging 1.00
R7920:Kcng1 UTSW 2 168262984 missense probably benign 0.03
R7984:Kcng1 UTSW 2 168262486 missense possibly damaging 0.93
R8494:Kcng1 UTSW 2 168263098 missense probably damaging 1.00
X0063:Kcng1 UTSW 2 168269073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCAGAGCTGCTGACGGTCTTAC -3'
(R):5'- TACCGGGAGACAACTCGCACTATG -3'

Sequencing Primer
(F):5'- AGTACAGCAGCTCCTCCTG -3'
(R):5'- GGAGACAACTCGCACTATGACTAC -3'
Posted On2013-08-06