Incidental Mutation 'R8312:Zmym6'
ID641431
Institutional Source Beutler Lab
Gene Symbol Zmym6
Ensembl Gene ENSMUSG00000042408
Gene Namezinc finger, MYM-type 6
SynonymsZfp258, D4Wsu24e, 9330177P20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8312 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127077383-127124372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127123834 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1136 (N1136S)
Ref Sequence ENSEMBL: ENSMUSP00000045366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046751] [ENSMUST00000094712] [ENSMUST00000094713] [ENSMUST00000106097]
Predicted Effect probably damaging
Transcript: ENSMUST00000046751
AA Change: N1136S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045366
Gene: ENSMUSG00000042408
AA Change: N1136S

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 241 277 4.01e1 SMART
TRASH 349 385 2.46e1 SMART
TRASH 391 426 3.32e2 SMART
TRASH 434 472 2.91e-1 SMART
TRASH 478 513 9.99e0 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 642 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094712
SMART Domains Protein: ENSMUSP00000092302
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX 5 103 9e-9 PFAM
Pfam:DoxX_2 7 124 4.8e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094713
AA Change: N1044S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092303
Gene: ENSMUSG00000042408
AA Change: N1044S

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 262 293 6.03e2 SMART
TRASH 299 334 3.32e2 SMART
TRASH 342 380 2.91e-1 SMART
TRASH 386 421 9.99e0 SMART
low complexity region 510 520 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106097
SMART Domains Protein: ENSMUSP00000101703
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX_2 27 111 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T C 12: 84,615,416 R23G probably damaging Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Agbl5 A G 5: 30,894,506 E556G probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arih2 A G 9: 108,644,274 S2P probably damaging Het
C87436 T A 6: 86,457,831 L387Q probably damaging Het
Card9 A T 2: 26,357,789 Y183* probably null Het
Cdk14 T C 5: 4,894,141 D394G probably benign Het
Cep135 C T 5: 76,636,899 S947L probably damaging Het
Cfb T C 17: 34,858,145 K505E probably benign Het
Cnot4 T A 6: 35,023,141 D708V probably damaging Het
Col16a1 T A 4: 130,054,451 L281M unknown Het
Col6a3 G T 1: 90,813,690 D673E possibly damaging Het
Ctdnep1 G A 11: 69,988,701 S150N probably benign Het
Fam175b A G 7: 132,876,600 Y163C probably damaging Het
Fanca T A 8: 123,269,810 probably benign Het
Fras1 T A 5: 96,588,191 N548K probably benign Het
Gbp2b A G 3: 142,599,051 M83V probably benign Het
Gbp2b C A 3: 142,599,054 P84T probably damaging Het
Gli2 A T 1: 118,868,112 probably benign Het
Greb1l A G 18: 10,511,587 probably benign Het
Grn A C 11: 102,436,247 K557T probably damaging Het
Hapln1 C T 13: 89,601,444 A36V probably benign Het
Heg1 C T 16: 33,726,675 R635W probably benign Het
Hivep1 C A 13: 42,155,177 Q298K possibly damaging Het
Hmcn1 A G 1: 150,738,764 I1297T probably damaging Het
Hp1bp3 T A 4: 138,223,439 probably benign Het
Htr4 C G 18: 62,437,478 F201L probably damaging Het
Insrr C G 3: 87,800,484 Q78E possibly damaging Het
Itga6 A T 2: 71,855,953 M1072L probably benign Het
Kdsr A G 1: 106,747,486 probably null Het
Klhl7 T C 5: 24,134,967 I149T probably damaging Het
Lce1l G C 3: 92,850,459 P31A unknown Het
Mag T C 7: 30,911,469 Y116C probably damaging Het
Mast2 A G 4: 116,430,486 S131P probably benign Het
Mlec C A 5: 115,150,207 probably null Het
Mrap2 G A 9: 87,169,659 probably null Het
Myo5b A G 18: 74,733,962 K1395E probably damaging Het
Nipa2 G A 7: 55,933,302 Q232* probably null Het
Oit3 T C 10: 59,438,810 N56S probably benign Het
Olfr155 A T 4: 43,854,461 I51F probably benign Het
Olfr165 T C 16: 19,407,237 M260V probably benign Het
Olfr9 A G 10: 128,990,478 T189A probably benign Het
Pax3 C T 1: 78,195,369 R68Q probably damaging Het
Pcnx2 G T 8: 125,762,850 H1668Q possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pkd1 A G 17: 24,567,128 S463G probably benign Het
Plb1 C T 5: 32,328,485 T871M probably damaging Het
Prdx1 A G 4: 116,699,201 D182G possibly damaging Het
Prkch T A 12: 73,760,584 F593I noncoding transcript Het
Psrc1 C T 3: 108,386,357 P194L probably benign Het
Ptp4a2 A T 4: 129,839,634 I18L probably benign Het
Samd10 A T 2: 181,596,875 L153H probably damaging Het
Shc3 T G 13: 51,442,718 H423P probably damaging Het
Siae A T 9: 37,646,297 I467F Het
Slc27a5 C T 7: 12,991,287 R411Q probably damaging Het
Spata24 A G 18: 35,660,808 I56T probably benign Het
Spns3 G A 11: 72,499,708 T407M probably damaging Het
Spta1 G A 1: 174,240,211 C2068Y probably damaging Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Thsd7a T C 6: 12,471,182 D479G Het
Trhde T C 10: 114,413,287 Y858C probably damaging Het
Ttn G A 2: 76,951,648 R1057C unknown Het
Tulp4 G T 17: 6,207,058 probably null Het
Tyk2 T C 9: 21,115,649 T613A possibly damaging Het
Ugt2b37 T C 5: 87,242,940 K356R probably benign Het
Vmn1r39 A G 6: 66,804,857 V159A noncoding transcript Het
Vps35 A G 8: 85,274,869 V440A possibly damaging Het
Whsc1l1 C T 8: 25,663,252 T536M probably damaging Het
Other mutations in Zmym6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Zmym6 APN 4 127101949 nonsense probably null
IGL00486:Zmym6 APN 4 127124185 utr 5 prime probably benign
IGL01017:Zmym6 APN 4 127088359 missense probably benign 0.00
IGL01385:Zmym6 APN 4 127124106 missense probably benign 0.02
IGL01577:Zmym6 APN 4 127105430 missense probably damaging 1.00
IGL01654:Zmym6 APN 4 127123726 missense probably damaging 1.00
IGL01736:Zmym6 APN 4 127108644 missense probably damaging 1.00
IGL01824:Zmym6 APN 4 127108706 missense probably damaging 0.99
IGL01916:Zmym6 APN 4 127123756 missense probably damaging 0.98
IGL01985:Zmym6 APN 4 127100748 missense probably damaging 1.00
IGL02056:Zmym6 APN 4 127103414 missense probably damaging 1.00
IGL02477:Zmym6 APN 4 127078502 nonsense probably null
IGL02754:Zmym6 APN 4 127109971 splice site probably benign
IGL03344:Zmym6 APN 4 127120521 missense probably damaging 1.00
IGL03412:Zmym6 APN 4 127092938 missense probably damaging 1.00
R0335:Zmym6 UTSW 4 127122808 missense probably damaging 1.00
R0448:Zmym6 UTSW 4 127108694 missense probably benign 0.01
R0463:Zmym6 UTSW 4 127122772 missense probably damaging 0.98
R0538:Zmym6 UTSW 4 127123369 missense probably benign 0.21
R0789:Zmym6 UTSW 4 127122822 missense possibly damaging 0.52
R0798:Zmym6 UTSW 4 127103523 missense probably benign 0.00
R1311:Zmym6 UTSW 4 127123358 missense probably damaging 1.00
R1351:Zmym6 UTSW 4 127123005 missense probably benign 0.00
R1429:Zmym6 UTSW 4 127123879 missense probably damaging 1.00
R1636:Zmym6 UTSW 4 127123767 missense probably damaging 0.99
R1666:Zmym6 UTSW 4 127122859 missense probably damaging 0.98
R1919:Zmym6 UTSW 4 127103414 missense probably damaging 1.00
R2058:Zmym6 UTSW 4 127088415 nonsense probably null
R3957:Zmym6 UTSW 4 127123296 missense possibly damaging 0.68
R3978:Zmym6 UTSW 4 127123555 missense possibly damaging 0.71
R4417:Zmym6 UTSW 4 127092988 missense probably damaging 1.00
R4801:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R4802:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R5052:Zmym6 UTSW 4 127123974 missense possibly damaging 0.92
R5105:Zmym6 UTSW 4 127123758 missense probably benign 0.33
R5217:Zmym6 UTSW 4 127105374 missense possibly damaging 0.76
R5682:Zmym6 UTSW 4 127104407 missense probably damaging 1.00
R5841:Zmym6 UTSW 4 127100670 missense possibly damaging 0.71
R5991:Zmym6 UTSW 4 127108473 splice site probably null
R6478:Zmym6 UTSW 4 127123383 missense possibly damaging 0.86
R7014:Zmym6 UTSW 4 127123544 nonsense probably null
R7287:Zmym6 UTSW 4 127122982 missense possibly damaging 0.50
R7290:Zmym6 UTSW 4 127123501 missense possibly damaging 0.73
R7371:Zmym6 UTSW 4 127104313 missense probably damaging 1.00
R7967:Zmym6 UTSW 4 127122660 missense probably benign 0.03
R8237:Zmym6 UTSW 4 127122751 missense probably damaging 0.99
R8306:Zmym6 UTSW 4 127122562 missense probably damaging 1.00
X0025:Zmym6 UTSW 4 127122350 missense possibly damaging 0.60
X0067:Zmym6 UTSW 4 127104314 missense probably damaging 1.00
Z1177:Zmym6 UTSW 4 127123797 missense not run
Predicted Primers PCR Primer
(F):5'- TCAAGTCTCCAAGGAACCATG -3'
(R):5'- CATGGAGCTTGGGATAACTTGTC -3'

Sequencing Primer
(F):5'- CTAAAAATGTGGTTGAAGCGTGCAC -3'
(R):5'- GTCTTTGCATTGACCCAAAACTGTG -3'
Posted On2020-07-28