Incidental Mutation 'R0104:Gm136'
ID64144
Institutional Source Beutler Lab
Gene Symbol Gm136
Ensembl Gene ENSMUSG00000071015
Gene Namepredicted gene 136
SynonymsLOC214568
MMRRC Submission 038390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0104 (G1)
Quality Score151
Status Not validated
Chromosome4
Chromosomal Location34743784-34756263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34746593 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 139 (H139Q)
Ref Sequence ENSEMBL: ENSMUSP00000092748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095129]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095129
AA Change: H139Q

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092748
Gene: ENSMUSG00000071015
AA Change: H139Q

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
coiled coil region 119 189 N/A INTRINSIC
coiled coil region 223 251 N/A INTRINSIC
Meta Mutation Damage Score 0.1329 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnah5 A T 15: 28,453,353 E4423D possibly damaging Het
Fsip2 A T 2: 82,978,973 T1879S possibly damaging Het
Ifrd2 T A 9: 107,587,917 L10H probably damaging Het
Itpr3 C A 17: 27,095,992 H704Q probably benign Het
Kcng1 A G 2: 168,269,046 I66T probably damaging Het
Kcnv2 T C 19: 27,323,219 Y157H probably damaging Het
Leng8 A G 7: 4,143,808 D443G probably damaging Het
Mlst8 T C 17: 24,476,117 N264S possibly damaging Het
Pcdhb8 A G 18: 37,355,665 E132G probably benign Het
Pmpcb C G 5: 21,746,038 S266* probably null Het
Prmt7 T C 8: 106,237,350 I292T probably damaging Het
Rif1 T C 2: 52,110,092 L1186S possibly damaging Het
Sox30 A C 11: 45,981,314 E332A possibly damaging Het
Taf2 T C 15: 55,038,338 D820G probably benign Het
Tas2r120 T A 6: 132,657,846 probably null Het
Zfp655 T C 5: 145,244,015 S228P probably damaging Het
Zfyve9 C A 4: 108,718,163 D574Y probably damaging Het
Other mutations in Gm136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gm136 APN 4 34752322 missense probably damaging 1.00
R0108:Gm136 UTSW 4 34746593 missense possibly damaging 0.65
R1221:Gm136 UTSW 4 34744127 missense possibly damaging 0.71
R1635:Gm136 UTSW 4 34750919 critical splice donor site probably null
R1674:Gm136 UTSW 4 34746662 splice site probably benign
R1971:Gm136 UTSW 4 34755986 missense probably benign 0.00
R2496:Gm136 UTSW 4 34746541 missense probably damaging 1.00
R4441:Gm136 UTSW 4 34755911 missense probably benign 0.35
R4901:Gm136 UTSW 4 34746580 nonsense probably null
R5300:Gm136 UTSW 4 34750930 missense probably damaging 0.98
R6609:Gm136 UTSW 4 34746526 missense probably benign
R6709:Gm136 UTSW 4 34755884 missense probably damaging 1.00
R6824:Gm136 UTSW 4 34746591 missense probably benign 0.15
R7098:Gm136 UTSW 4 34746628 missense probably benign 0.08
R7689:Gm136 UTSW 4 34743875 missense probably null 0.00
R8249:Gm136 UTSW 4 34750955 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTAACTTGCCGATGTGCTCTCTG -3'
(R):5'- CTCCAGTAAATGTGTGTTGCTTGCC -3'

Sequencing Primer
(F):5'- GGAGTACCTTTTCTCTTCTTCGATAG -3'
(R):5'- TTAGCATCTGTGAGACCCCAG -3'
Posted On2013-08-06