Incidental Mutation 'R8312:Siae'
ID641455
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Namesialic acid acetylesterase
SynonymsLSE, clone 165, Ysg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8312 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37555698-37649655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37646297 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 467 (I467F)
Ref Sequence ENSEMBL: ENSMUSP00000002007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000117654]
Predicted Effect
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942
AA Change: I467F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117654
SMART Domains Protein: ENSMUSP00000112600
Gene: ENSMUSG00000011114

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
coiled coil region 56 79 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 124 156 N/A INTRINSIC
FYRN 192 235 1.05e-18 SMART
Pfam:FYRC 238 316 1.4e-23 PFAM
low complexity region 349 354 N/A INTRINSIC
Meta Mutation Damage Score 0.1463 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T C 12: 84,615,416 R23G probably damaging Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Agbl5 A G 5: 30,894,506 E556G probably damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Arih2 A G 9: 108,644,274 S2P probably damaging Het
C87436 T A 6: 86,457,831 L387Q probably damaging Het
Card9 A T 2: 26,357,789 Y183* probably null Het
Cdk14 T C 5: 4,894,141 D394G probably benign Het
Cep135 C T 5: 76,636,899 S947L probably damaging Het
Cfb T C 17: 34,858,145 K505E probably benign Het
Cnot4 T A 6: 35,023,141 D708V probably damaging Het
Col16a1 T A 4: 130,054,451 L281M unknown Het
Col6a3 G T 1: 90,813,690 D673E possibly damaging Het
Ctdnep1 G A 11: 69,988,701 S150N probably benign Het
Fam175b A G 7: 132,876,600 Y163C probably damaging Het
Fanca T A 8: 123,269,810 probably benign Het
Fras1 T A 5: 96,588,191 N548K probably benign Het
Gbp2b A G 3: 142,599,051 M83V probably benign Het
Gbp2b C A 3: 142,599,054 P84T probably damaging Het
Gli2 A T 1: 118,868,112 probably benign Het
Greb1l A G 18: 10,511,587 probably benign Het
Grn A C 11: 102,436,247 K557T probably damaging Het
Hapln1 C T 13: 89,601,444 A36V probably benign Het
Heg1 C T 16: 33,726,675 R635W probably benign Het
Hivep1 C A 13: 42,155,177 Q298K possibly damaging Het
Hmcn1 A G 1: 150,738,764 I1297T probably damaging Het
Hp1bp3 T A 4: 138,223,439 probably benign Het
Htr4 C G 18: 62,437,478 F201L probably damaging Het
Insrr C G 3: 87,800,484 Q78E possibly damaging Het
Itga6 A T 2: 71,855,953 M1072L probably benign Het
Kdsr A G 1: 106,747,486 probably null Het
Klhl7 T C 5: 24,134,967 I149T probably damaging Het
Lce1l G C 3: 92,850,459 P31A unknown Het
Mag T C 7: 30,911,469 Y116C probably damaging Het
Mast2 A G 4: 116,430,486 S131P probably benign Het
Mlec C A 5: 115,150,207 probably null Het
Mrap2 G A 9: 87,169,659 probably null Het
Myo5b A G 18: 74,733,962 K1395E probably damaging Het
Nipa2 G A 7: 55,933,302 Q232* probably null Het
Oit3 T C 10: 59,438,810 N56S probably benign Het
Olfr155 A T 4: 43,854,461 I51F probably benign Het
Olfr165 T C 16: 19,407,237 M260V probably benign Het
Olfr9 A G 10: 128,990,478 T189A probably benign Het
Pax3 C T 1: 78,195,369 R68Q probably damaging Het
Pcnx2 G T 8: 125,762,850 H1668Q possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pkd1 A G 17: 24,567,128 S463G probably benign Het
Plb1 C T 5: 32,328,485 T871M probably damaging Het
Prdx1 A G 4: 116,699,201 D182G possibly damaging Het
Prkch T A 12: 73,760,584 F593I noncoding transcript Het
Psrc1 C T 3: 108,386,357 P194L probably benign Het
Ptp4a2 A T 4: 129,839,634 I18L probably benign Het
Samd10 A T 2: 181,596,875 L153H probably damaging Het
Shc3 T G 13: 51,442,718 H423P probably damaging Het
Slc27a5 C T 7: 12,991,287 R411Q probably damaging Het
Spata24 A G 18: 35,660,808 I56T probably benign Het
Spns3 G A 11: 72,499,708 T407M probably damaging Het
Spta1 G A 1: 174,240,211 C2068Y probably damaging Het
Svs2 C A 2: 164,238,171 G25W probably damaging Het
Thsd7a T C 6: 12,471,182 D479G Het
Trhde T C 10: 114,413,287 Y858C probably damaging Het
Ttn G A 2: 76,951,648 R1057C unknown Het
Tulp4 G T 17: 6,207,058 probably null Het
Tyk2 T C 9: 21,115,649 T613A possibly damaging Het
Ugt2b37 T C 5: 87,242,940 K356R probably benign Het
Vmn1r39 A G 6: 66,804,857 V159A noncoding transcript Het
Vps35 A G 8: 85,274,869 V440A possibly damaging Het
Whsc1l1 C T 8: 25,663,252 T536M probably damaging Het
Zmym6 A G 4: 127,123,834 N1136S probably damaging Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
BB009:Siae UTSW 9 37633684 missense probably benign 0.12
BB019:Siae UTSW 9 37633684 missense probably benign 0.12
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
R7697:Siae UTSW 9 37633654 missense probably damaging 1.00
R7821:Siae UTSW 9 37644900 missense probably damaging 1.00
R7932:Siae UTSW 9 37633684 missense probably benign 0.12
R8377:Siae UTSW 9 37631605 critical splice donor site probably null
R8868:Siae UTSW 9 37616836 missense probably damaging 1.00
Z1176:Siae UTSW 9 37631469 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACTAGGCATGTGTTCTTCCAAG -3'
(R):5'- GTGTGGTAAACAGCACATTGC -3'

Sequencing Primer
(F):5'- GGCATGTGTTCTTCCAAGCTATTATC -3'
(R):5'- GCACATTGCTTATATTCACAAGGCC -3'
Posted On2020-07-28