Incidental Mutation 'R8313:Trak2'
ID641479
Institutional Source Beutler Lab
Gene Symbol Trak2
Ensembl Gene ENSMUSG00000026028
Gene Nametrafficking protein, kinesin binding 2
SynonymsGRIF-1, 4733401O11Rik, GRIF1, OIP98, CALS-C, 2900022D04Rik, Als2cr3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58900449-58973430 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58921147 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 232 (C232*)
Ref Sequence ENSEMBL: ENSMUSP00000027186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027186] [ENSMUST00000174120]
Predicted Effect probably null
Transcript: ENSMUST00000027186
AA Change: C232*
SMART Domains Protein: ENSMUSP00000027186
Gene: ENSMUSG00000026028
AA Change: C232*

DomainStartEndE-ValueType
Pfam:HAP1_N 48 353 2.5e-135 PFAM
Pfam:Milton 426 565 3e-26 PFAM
low complexity region 663 673 N/A INTRINSIC
low complexity region 693 714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174120
AA Change: C232*
SMART Domains Protein: ENSMUSP00000134253
Gene: ENSMUSG00000026028
AA Change: C232*

DomainStartEndE-ValueType
Pfam:HAP1_N 47 354 1.3e-129 PFAM
Pfam:Milton 411 565 1.1e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Trak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Trak2 APN 1 58923607 missense probably damaging 1.00
IGL01982:Trak2 APN 1 58926655 missense possibly damaging 0.94
IGL02154:Trak2 APN 1 58908729 missense probably damaging 1.00
IGL02399:Trak2 APN 1 58910045 missense probably benign 0.00
IGL02732:Trak2 APN 1 58910063 missense probably benign 0.19
IGL02734:Trak2 APN 1 58910063 missense probably benign 0.19
IGL03147:Trak2 UTSW 1 58910063 missense probably benign 0.19
P0041:Trak2 UTSW 1 58909964 missense probably damaging 1.00
R0079:Trak2 UTSW 1 58926724 missense probably damaging 1.00
R0791:Trak2 UTSW 1 58903661 missense probably benign
R0792:Trak2 UTSW 1 58903661 missense probably benign
R1099:Trak2 UTSW 1 58921841 missense probably benign 0.05
R1899:Trak2 UTSW 1 58946336 start codon destroyed probably null 0.98
R1903:Trak2 UTSW 1 58918855 splice site probably null
R2292:Trak2 UTSW 1 58935757 missense probably damaging 0.99
R2312:Trak2 UTSW 1 58935782 missense probably damaging 1.00
R3720:Trak2 UTSW 1 58946245 critical splice donor site probably null
R4966:Trak2 UTSW 1 58919321 missense probably damaging 1.00
R5088:Trak2 UTSW 1 58935808 missense probably benign 0.06
R5730:Trak2 UTSW 1 58921807 missense probably damaging 1.00
R5840:Trak2 UTSW 1 58919273 missense probably damaging 1.00
R5981:Trak2 UTSW 1 58908690 missense probably benign 0.01
R6000:Trak2 UTSW 1 58911812 missense possibly damaging 0.71
R6053:Trak2 UTSW 1 58904069 missense possibly damaging 0.62
R6894:Trak2 UTSW 1 58911733 missense probably damaging 1.00
R6916:Trak2 UTSW 1 58910025 missense probably benign 0.06
R7096:Trak2 UTSW 1 58903590 missense probably damaging 1.00
R7544:Trak2 UTSW 1 58921068 splice site probably null
R7847:Trak2 UTSW 1 58935818 missense possibly damaging 0.88
R7889:Trak2 UTSW 1 58918824 missense probably damaging 1.00
R8039:Trak2 UTSW 1 58946288 missense probably benign 0.16
X0067:Trak2 UTSW 1 58908532 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TAGAGGACCACACTGAGCTG -3'
(R):5'- GAGGTCCTTGACTGTCATACCTC -3'

Sequencing Primer
(F):5'- CAGCAGCTATTCTGTTATAGTGACGC -3'
(R):5'- GTCCTTGACTGTCATACCTCCTCTAG -3'
Posted On2020-07-28