Incidental Mutation 'R8313:Ubr3'
ID641482
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69945134 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 589 (H589R)
Ref Sequence ENSEMBL: ENSMUSP00000060159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably damaging
Transcript: ENSMUST00000055758
AA Change: H589R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: H589R

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112251
AA Change: H588R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: H588R

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 splice site probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
R7737:Ubr3 UTSW 2 69991566 missense probably benign 0.07
R7743:Ubr3 UTSW 2 69944449 missense probably benign 0.28
R7946:Ubr3 UTSW 2 69951395 missense possibly damaging 0.95
R7991:Ubr3 UTSW 2 69952856 missense probably damaging 1.00
R8071:Ubr3 UTSW 2 69988876 missense probably damaging 0.99
R8136:Ubr3 UTSW 2 70021179 missense probably damaging 1.00
R8296:Ubr3 UTSW 2 69954362 missense probably null 1.00
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Z1177:Ubr3 UTSW 2 69897461 missense probably benign 0.17
Z1177:Ubr3 UTSW 2 69897666 missense probably damaging 1.00
Z1177:Ubr3 UTSW 2 69973206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGCCACATACACGTGTCTATCTG -3'
(R):5'- ACACCACAGGCAGATTATTATGAAG -3'

Sequencing Primer
(F):5'- TATCTGACAAACCCACATGTACTTTC -3'
(R):5'- CTGTTCAAAACGGGCAGCTG -3'
Posted On2020-07-28