Incidental Mutation 'R8313:Mdk'
ID641483
Institutional Source Beutler Lab
Gene Symbol Mdk
Ensembl Gene ENSMUSG00000027239
Gene Namemidkine
SynonymsMK, Mek
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location91929805-91932297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91930833 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 128 (K128E)
Ref Sequence ENSEMBL: ENSMUSP00000028672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000028672] [ENSMUST00000045537] [ENSMUST00000069423] [ENSMUST00000090602] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000111309] [ENSMUST00000128152] [ENSMUST00000142231]
Predicted Effect probably benign
Transcript: ENSMUST00000028667
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000028672
AA Change: K128E
SMART Domains Protein: ENSMUSP00000028672
Gene: ENSMUSG00000027239
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045537
SMART Domains Protein: ENSMUSP00000040808
Gene: ENSMUSG00000040495

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 42 248 5.7e-7 PFAM
Pfam:7tm_1 48 453 5.5e-76 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000069423
AA Change: K128E
SMART Domains Protein: ENSMUSP00000068413
Gene: ENSMUSG00000027239
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000090602
AA Change: K128E
SMART Domains Protein: ENSMUSP00000088090
Gene: ENSMUSG00000027239
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099709
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111303
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000111309
AA Change: K128E
SMART Domains Protein: ENSMUSP00000106941
Gene: ENSMUSG00000027239
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
PTN 34 113 4.2e-53 SMART
low complexity region 120 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142231
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted growth factor that belongs to the pleiotrophin/midkine heparin-binding protein family and functions in a variety of biological processes. The encoded cytokine promotes the growth, differentiation, survival and migration of several target cells including leucocytes involved in inflammation. This protein plays a role in the formation of scar tissue and intraperitoneal adhesions, and promotes neurite outgrowth and neuron survival. The protein encoded by this gene is associated with obesity and inhibition of insulin signaling in fat cells. A pseudogene of this gene is present on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal except for some delayed development of the hippocampus and behavioral abnormalities when young. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Mdk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Mdk APN 2 91931116 missense probably damaging 1.00
R5774:Mdk UTSW 2 91931224 missense probably damaging 0.96
R7182:Mdk UTSW 2 91930852 missense unknown
R7873:Mdk UTSW 2 91931428 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAGGTCGGATGATCCAACAG -3'
(R):5'- AGGGTATGTCCTTATAAACCGGAGG -3'

Sequencing Primer
(F):5'- CAGAAAGAGTAGTTCCTACTTGGGC -3'
(R):5'- GGACATCCACAACCCTCCTGTC -3'
Posted On2020-07-28