Incidental Mutation 'R8313:Bpifa6'
ID641484
Institutional Source Beutler Lab
Gene Symbol Bpifa6
Ensembl Gene ENSMUSG00000078998
Gene NameBPI fold containing family A, member 6
SynonymsGm5840
Accession Numbers

Genbank: NM_001080811MGI: 3647736  

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location153974945-154000495 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 153989258 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 248 (L248*)
Ref Sequence ENSEMBL: ENSMUSP00000105375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109753]
Predicted Effect probably null
Transcript: ENSMUST00000109753
AA Change: L248*
SMART Domains Protein: ENSMUSP00000105375
Gene: ENSMUSG00000078998
AA Change: L248*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LBP_BPI_CETP 176 319 1.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Bpifa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Bpifa6 APN 2 153990466 missense probably benign 0.00
IGL01805:Bpifa6 APN 2 153984912 missense probably benign 0.03
IGL02246:Bpifa6 APN 2 153989276 missense probably damaging 0.98
IGL02275:Bpifa6 APN 2 153992272 missense probably benign 0.40
IGL02405:Bpifa6 APN 2 153990862 nonsense probably null
IGL02587:Bpifa6 APN 2 153989210 missense probably damaging 0.99
IGL03365:Bpifa6 APN 2 153989284 missense possibly damaging 0.71
F6893:Bpifa6 UTSW 2 153987158 missense probably damaging 1.00
FR4976:Bpifa6 UTSW 2 153986376 missense probably benign
FR4976:Bpifa6 UTSW 2 153986398 missense probably benign
R0131:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0131:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0132:Bpifa6 UTSW 2 153982931 missense probably benign 0.11
R0799:Bpifa6 UTSW 2 153992272 missense probably benign 0.40
R1468:Bpifa6 UTSW 2 153989272 missense probably benign 0.01
R1468:Bpifa6 UTSW 2 153989272 missense probably benign 0.01
R1767:Bpifa6 UTSW 2 153987227 missense possibly damaging 0.95
R2255:Bpifa6 UTSW 2 153990895 missense probably damaging 0.98
R2857:Bpifa6 UTSW 2 153989274 missense probably benign 0.03
R3430:Bpifa6 UTSW 2 153989251 missense probably benign 0.00
R4616:Bpifa6 UTSW 2 153982988 missense possibly damaging 0.47
R5420:Bpifa6 UTSW 2 153989330 missense probably damaging 0.98
R6224:Bpifa6 UTSW 2 153987153 missense probably damaging 0.99
R6483:Bpifa6 UTSW 2 153990434 missense probably benign 0.13
R6552:Bpifa6 UTSW 2 153987158 missense probably damaging 0.99
R7061:Bpifa6 UTSW 2 153992316 missense probably benign 0.00
R7378:Bpifa6 UTSW 2 153986433 missense probably damaging 0.99
R7472:Bpifa6 UTSW 2 153989329 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TATGTGTATCAGTTACCTCTCAGC -3'
(R):5'- CAGGGCATTAAAACACTAGTGGC -3'

Sequencing Primer
(F):5'- GCCATAAATGCCCAGACCTGTTTG -3'
(R):5'- GACAGATTCCATGGAGCCTG -3'
Posted On2020-07-28