Incidental Mutation 'R8313:Atp13a2'
ID641489
Institutional Source Beutler Lab
Gene Symbol Atp13a2
Ensembl Gene ENSMUSG00000036622
Gene NameATPase type 13A2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location140986873-141007330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141002735 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 646 (V646I)
Ref Sequence ENSEMBL: ENSMUSP00000039648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]
Predicted Effect probably benign
Transcript: ENSMUST00000037055
AA Change: V646I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622
AA Change: V646I

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 171 8.9e-27 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 497 3.6e-39 PFAM
Pfam:Hydrolase 502 785 2e-14 PFAM
Pfam:HAD 505 876 3.6e-27 PFAM
transmembrane domain 920 942 N/A INTRINSIC
transmembrane domain 957 979 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1033 1055 N/A INTRINSIC
transmembrane domain 1068 1090 N/A INTRINSIC
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127833
AA Change: V646I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622
AA Change: V646I

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 164 7.4e-29 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 496 6e-34 PFAM
Pfam:HAD 505 876 4e-27 PFAM
Pfam:Hydrolase 663 879 2.5e-15 PFAM
transmembrane domain 925 947 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
low complexity region 1102 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168047
AA Change: V729I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: V729I

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 156 1e-27 PFAM
Cation_ATPase_N 262 334 9.78e-1 SMART
Pfam:E1-E2_ATPase 339 579 4.8e-34 PFAM
Pfam:HAD 588 959 3e-27 PFAM
Pfam:Hydrolase 726 962 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Atp13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Atp13a2 APN 4 140992198 missense probably benign 0.02
IGL01476:Atp13a2 APN 4 141000770 missense probably damaging 1.00
IGL01980:Atp13a2 APN 4 141006152 missense probably benign 0.00
IGL02257:Atp13a2 APN 4 141006089 missense probably benign 0.00
IGL02589:Atp13a2 APN 4 141006411 missense probably damaging 1.00
IGL02936:Atp13a2 APN 4 141001949 missense probably benign 0.00
IGL03032:Atp13a2 APN 4 141000355 missense possibly damaging 0.95
IGL03040:Atp13a2 APN 4 141006173 missense probably damaging 1.00
IGL03271:Atp13a2 APN 4 141000397 missense possibly damaging 0.69
calla UTSW 4 140994332 nonsense probably null
eastern_moon UTSW 4 141005016 missense probably damaging 0.99
yucca_brevifolia UTSW 4 140993802 missense probably damaging 1.00
IGL03054:Atp13a2 UTSW 4 141006968 missense possibly damaging 0.83
PIT4469001:Atp13a2 UTSW 4 140994127 missense unknown
R0634:Atp13a2 UTSW 4 141006929 unclassified probably benign
R0881:Atp13a2 UTSW 4 141003931 missense probably damaging 1.00
R1295:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1296:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1472:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1780:Atp13a2 UTSW 4 141002460 missense possibly damaging 0.73
R1837:Atp13a2 UTSW 4 140994332 nonsense probably null
R1838:Atp13a2 UTSW 4 140994332 nonsense probably null
R1856:Atp13a2 UTSW 4 141004012 missense probably benign 0.43
R1918:Atp13a2 UTSW 4 140996371 missense possibly damaging 0.90
R1956:Atp13a2 UTSW 4 141004261 missense possibly damaging 0.92
R2126:Atp13a2 UTSW 4 140995391 missense possibly damaging 0.94
R2130:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2132:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2133:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2397:Atp13a2 UTSW 4 141003155 missense probably benign 0.00
R2873:Atp13a2 UTSW 4 141002983 missense probably benign 0.00
R3025:Atp13a2 UTSW 4 140994348 missense probably damaging 1.00
R3939:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3940:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3942:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R4247:Atp13a2 UTSW 4 140992228 critical splice donor site probably null
R4357:Atp13a2 UTSW 4 141001904 missense probably benign 0.01
R4406:Atp13a2 UTSW 4 141006476 missense probably damaging 1.00
R4686:Atp13a2 UTSW 4 141003276 critical splice donor site probably null
R5033:Atp13a2 UTSW 4 141000821 missense possibly damaging 0.91
R5066:Atp13a2 UTSW 4 141005138 missense probably damaging 1.00
R5278:Atp13a2 UTSW 4 141000818 missense probably damaging 0.97
R5464:Atp13a2 UTSW 4 141006070 missense probably damaging 1.00
R5522:Atp13a2 UTSW 4 141004360 splice site probably null
R5614:Atp13a2 UTSW 4 140992182 missense probably benign 0.35
R5846:Atp13a2 UTSW 4 140995596 missense possibly damaging 0.81
R6378:Atp13a2 UTSW 4 141007056 missense probably benign 0.34
R6512:Atp13a2 UTSW 4 141003218 missense probably damaging 1.00
R6518:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R6519:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R7166:Atp13a2 UTSW 4 141006984 missense possibly damaging 0.89
R7178:Atp13a2 UTSW 4 140999151 missense probably damaging 1.00
R7657:Atp13a2 UTSW 4 140992504 missense possibly damaging 0.92
R8256:Atp13a2 UTSW 4 140995611 missense possibly damaging 0.94
R8318:Atp13a2 UTSW 4 141007024 missense probably benign 0.14
Z1176:Atp13a2 UTSW 4 141005117 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTTGGTGGTAATGAGACCCC -3'
(R):5'- GAAAAGTCGCTGGGTACTGTGG -3'

Sequencing Primer
(F):5'- GTGGTAATGAGACCCCCACCC -3'
(R):5'- TACTGTGGAGGGAGAGAGGTATC -3'
Posted On2020-07-28