Incidental Mutation 'R8313:Prmt8'
ID641494
Institutional Source Beutler Lab
Gene Symbol Prmt8
Ensembl Gene ENSMUSG00000030350
Gene Nameprotein arginine N-methyltransferase 8
SynonymsHrmt1l3, Hrmt1l4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location127689011-127769472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127689850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 387 (V387A)
Ref Sequence ENSEMBL: ENSMUSP00000032500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032500]
Predicted Effect probably benign
Transcript: ENSMUST00000032500
AA Change: V387A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032500
Gene: ENSMUSG00000030350
AA Change: V387A

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:PRMT5 80 368 4.5e-7 PFAM
Pfam:PrmA 102 200 2e-10 PFAM
Pfam:Methyltransf_31 110 274 7.3e-9 PFAM
Pfam:Methyltransf_18 111 215 9.9e-8 PFAM
Pfam:Methyltransf_11 116 215 6.2e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit abnormal Purkinje cell dendrite morphology, hyperactivity, limb grasping and gait abnormalities, and show reduced levels of acetylcholine and choline along with increased phosphatidylcholine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Prmt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Prmt8 APN 6 127690717 missense probably benign 0.17
IGL02178:Prmt8 APN 6 127697807 missense probably benign 0.06
IGL02526:Prmt8 APN 6 127711823 missense probably damaging 0.96
IGL03010:Prmt8 APN 6 127729535 missense probably benign 0.09
IGL03037:Prmt8 APN 6 127703977 missense possibly damaging 0.75
R0096:Prmt8 UTSW 6 127732627 splice site probably benign
R0254:Prmt8 UTSW 6 127711808 missense probably damaging 1.00
R0355:Prmt8 UTSW 6 127711874 nonsense probably null
R0925:Prmt8 UTSW 6 127697813 missense probably benign 0.00
R1606:Prmt8 UTSW 6 127689836 nonsense probably null
R1716:Prmt8 UTSW 6 127726523 critical splice donor site probably null
R3789:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3790:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3958:Prmt8 UTSW 6 127732744 missense probably benign 0.00
R5022:Prmt8 UTSW 6 127711163 missense possibly damaging 0.92
R5143:Prmt8 UTSW 6 127732714 missense probably benign
R5635:Prmt8 UTSW 6 127768729 missense probably damaging 1.00
R5816:Prmt8 UTSW 6 127697738 missense probably benign 0.09
R5959:Prmt8 UTSW 6 127729418 missense probably damaging 1.00
R6267:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6296:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6450:Prmt8 UTSW 6 127732643 missense possibly damaging 0.71
R6603:Prmt8 UTSW 6 127729413 missense probably benign 0.00
R7208:Prmt8 UTSW 6 127689829 missense possibly damaging 0.81
R7629:Prmt8 UTSW 6 127689883 nonsense probably null
R7719:Prmt8 UTSW 6 127729503 missense probably damaging 0.97
R8346:Prmt8 UTSW 6 127711847 missense probably damaging 1.00
R8404:Prmt8 UTSW 6 127689862 missense possibly damaging 0.93
X0020:Prmt8 UTSW 6 127697771 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCTTCCATCCTCAGAGCC -3'
(R):5'- AGAACTCCCGTGGCTACCTATC -3'

Sequencing Primer
(F):5'- CCAGCCATAGCACGGAAGG -3'
(R):5'- GTGGCTACCTATCCCCATGG -3'
Posted On2020-07-28