Incidental Mutation 'R8313:Fcgbp'
ID 641497
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene Name Fc fragment of IgG binding protein
Synonyms A430096B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8313 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 28071236-28120862 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28086344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 402 (D402G)
Ref Sequence ENSEMBL: ENSMUSP00000075945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
AlphaFold E9Q0B5
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: D402G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: D402G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: D402G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: D402G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
bilge UTSW 7 28117337 missense probably benign 0.00
R6548_fcgbp_365 UTSW 7 28091918 missense probably benign 0.00
swill UTSW 7 28089734 missense probably damaging 1.00
G1citation:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
R7831:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7835:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R7947:Fcgbp UTSW 7 28104170 critical splice donor site probably null
R8086:Fcgbp UTSW 7 28113964 missense probably damaging 1.00
R8137:Fcgbp UTSW 7 28105071 missense probably damaging 1.00
R8154:Fcgbp UTSW 7 28085082 missense probably benign 0.00
R8169:Fcgbp UTSW 7 28085494 critical splice donor site probably null
R8176:Fcgbp UTSW 7 28091749 missense possibly damaging 0.88
R8193:Fcgbp UTSW 7 28104851 missense probably damaging 1.00
R8350:Fcgbp UTSW 7 28094189 missense probably benign 0.02
R8382:Fcgbp UTSW 7 28117337 missense probably benign 0.00
R8393:Fcgbp UTSW 7 28107390 missense probably benign 0.18
R8438:Fcgbp UTSW 7 28089806 missense probably benign 0.25
R8489:Fcgbp UTSW 7 28105010 missense possibly damaging 0.94
R8495:Fcgbp UTSW 7 28086553 missense probably damaging 1.00
R8707:Fcgbp UTSW 7 28120495 missense probably benign 0.01
R8736:Fcgbp UTSW 7 28106196 missense probably benign 0.05
R8816:Fcgbp UTSW 7 28084987 missense probably benign 0.09
R8905:Fcgbp UTSW 7 28086509 missense probably damaging 1.00
R9031:Fcgbp UTSW 7 28091483 missense possibly damaging 0.89
R9063:Fcgbp UTSW 7 28091852 missense probably damaging 1.00
R9180:Fcgbp UTSW 7 28103773 nonsense probably null
R9262:Fcgbp UTSW 7 28120527 missense probably damaging 1.00
R9439:Fcgbp UTSW 7 28104011 missense not run
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Z1186:Fcgbp UTSW 7 28086191 missense probably benign
Z1186:Fcgbp UTSW 7 28089755 missense probably benign
Z1186:Fcgbp UTSW 7 28091647 missense probably benign
Z1186:Fcgbp UTSW 7 28093345 missense probably benign
Z1186:Fcgbp UTSW 7 28103884 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGCTGCTATGATCCTTGCAG -3'
(R):5'- AGTCAAAGCGCTTTCCATCG -3'

Sequencing Primer
(F):5'- GCTATGATCCTTGCAGCCCTG -3'
(R):5'- TCGAAGCTCACATAGTGCG -3'
Posted On 2020-07-28