Incidental Mutation 'R0104:Ifrd2'
ID64150
Institutional Source Beutler Lab
Gene Symbol Ifrd2
Ensembl Gene ENSMUSG00000010048
Gene Nameinterferon-related developmental regulator 2
Synonyms1810034A24Rik, SKMc15
MMRRC Submission 038390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0104 (G1)
Quality Score106
Status Not validated
Chromosome9
Chromosomal Location107587642-107593385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107587917 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 10 (L10H)
Ref Sequence ENSEMBL: ENSMUSP00000141718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010192] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000122985] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000148440] [ENSMUST00000149487] [ENSMUST00000149638] [ENSMUST00000195725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010192
AA Change: L10H

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000010192
Gene: ENSMUSG00000010048
AA Change: L10H

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 31 340 7.3e-101 PFAM
Pfam:IFRD_C 385 438 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093785
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122985
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127380
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130053
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139274
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139581
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149487
SMART Domains Protein: ENSMUSP00000117845
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 301 4.9e-103 PFAM
Pfam:Glyco_hydro_56 291 325 6.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149638
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect probably damaging
Transcript: ENSMUST00000195725
AA Change: L10H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141718
Gene: ENSMUSG00000010048
AA Change: L10H

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 32 139 5.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193153
Predicted Effect probably benign
Transcript: ENSMUST00000193140
Predicted Effect probably benign
Transcript: ENSMUST00000195746
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnah5 A T 15: 28,453,353 E4423D possibly damaging Het
Fsip2 A T 2: 82,978,973 T1879S possibly damaging Het
Gm136 G T 4: 34,746,593 H139Q possibly damaging Het
Itpr3 C A 17: 27,095,992 H704Q probably benign Het
Kcng1 A G 2: 168,269,046 I66T probably damaging Het
Kcnv2 T C 19: 27,323,219 Y157H probably damaging Het
Leng8 A G 7: 4,143,808 D443G probably damaging Het
Mlst8 T C 17: 24,476,117 N264S possibly damaging Het
Pcdhb8 A G 18: 37,355,665 E132G probably benign Het
Pmpcb C G 5: 21,746,038 S266* probably null Het
Prmt7 T C 8: 106,237,350 I292T probably damaging Het
Rif1 T C 2: 52,110,092 L1186S possibly damaging Het
Sox30 A C 11: 45,981,314 E332A possibly damaging Het
Taf2 T C 15: 55,038,338 D820G probably benign Het
Tas2r120 T A 6: 132,657,846 probably null Het
Zfp655 T C 5: 145,244,015 S228P probably damaging Het
Zfyve9 C A 4: 108,718,163 D574Y probably damaging Het
Other mutations in Ifrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Ifrd2 APN 9 107592132 missense probably benign 0.10
IGL02185:Ifrd2 APN 9 107591091 missense probably benign 0.01
IGL02737:Ifrd2 APN 9 107592170 missense probably benign
R2072:Ifrd2 UTSW 9 107592545 missense probably damaging 1.00
R2850:Ifrd2 UTSW 9 107591709 splice site probably benign
R3015:Ifrd2 UTSW 9 107590022 missense probably null 1.00
R3727:Ifrd2 UTSW 9 107591682 nonsense probably null
R5175:Ifrd2 UTSW 9 107590625 missense probably damaging 1.00
R5580:Ifrd2 UTSW 9 107592312 missense probably damaging 1.00
R5593:Ifrd2 UTSW 9 107590175 missense probably damaging 1.00
R6255:Ifrd2 UTSW 9 107592091 missense probably damaging 0.99
R6905:Ifrd2 UTSW 9 107587890 start codon destroyed probably null 0.98
R7414:Ifrd2 UTSW 9 107590171 missense possibly damaging 0.60
R7532:Ifrd2 UTSW 9 107592522 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCCAGCGACCCATTTGACAG -3'
(R):5'- GGTGTGGTTTTCTACCCCAGTAGC -3'

Sequencing Primer
(F):5'- ACCCATTTGACAGGGCGG -3'
(R):5'- CTTAATGCTGGTCAAGTCATCG -3'
Posted On2013-08-06