Incidental Mutation 'R8313:Pkm'
ID641507
Institutional Source Beutler Lab
Gene Symbol Pkm
Ensembl Gene ENSMUSG00000032294
Gene Namepyruvate kinase, muscle
SynonymsPkm2, Pk-3, Pk-2, Pk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location59656368-59679375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59668619 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 106 (R106L)
Ref Sequence ENSEMBL: ENSMUSP00000034834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034834] [ENSMUST00000163694]
Predicted Effect probably benign
Transcript: ENSMUST00000034834
AA Change: R106L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034834
Gene: ENSMUSG00000032294
AA Change: R106L

DomainStartEndE-ValueType
Pfam:PK 42 395 1.3e-172 PFAM
Pfam:PK_C 409 529 3.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163694
AA Change: R106L

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128770
Gene: ENSMUSG00000032294
AA Change: R106L

DomainStartEndE-ValueType
Pfam:PK 42 395 2.6e-174 PFAM
Pfam:PK_C 410 528 1.9e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit prenatal lethality around the time of implanatation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Pkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:Pkm APN 9 59670522 missense probably damaging 1.00
IGL02014:Pkm APN 9 59668961 missense possibly damaging 0.59
IGL02054:Pkm APN 9 59678201 missense probably damaging 1.00
negligible UTSW 9 59670634 missense probably damaging 1.00
R0087:Pkm UTSW 9 59678099 nonsense probably null
R0603:Pkm UTSW 9 59665881 missense probably damaging 0.97
R0940:Pkm UTSW 9 59668535 splice site probably benign
R0990:Pkm UTSW 9 59678096 missense probably damaging 1.00
R1446:Pkm UTSW 9 59668910 splice site probably null
R5104:Pkm UTSW 9 59668681 critical splice donor site probably null
R5369:Pkm UTSW 9 59670634 missense probably damaging 1.00
R6831:Pkm UTSW 9 59675115 missense probably benign
R6974:Pkm UTSW 9 59668570 missense probably damaging 0.99
R7169:Pkm UTSW 9 59671625 missense possibly damaging 0.95
R7288:Pkm UTSW 9 59668913 missense probably benign 0.00
R7621:Pkm UTSW 9 59678158 nonsense probably null
R7844:Pkm UTSW 9 59670722 missense probably benign 0.00
R8217:Pkm UTSW 9 59678809 missense possibly damaging 0.74
R8234:Pkm UTSW 9 59670599 missense possibly damaging 0.87
R8301:Pkm UTSW 9 59668631 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGGCAGTATTCTGGAAC -3'
(R):5'- CGCTCAACTCTGGCTCAAAG -3'

Sequencing Primer
(F):5'- GCAGTATTCTGGAACTGTATGAGAG -3'
(R):5'- ACTCTGGCTCAAAGTCCAAAG -3'
Posted On2020-07-28