Incidental Mutation 'R0104:Sox30'
ID64151
Institutional Source Beutler Lab
Gene Symbol Sox30
Ensembl Gene ENSMUSG00000040489
Gene NameSRY (sex determining region Y)-box 30
Synonyms
MMRRC Submission 038390-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0104 (G1)
Quality Score108
Status Not validated
Chromosome11
Chromosomal Location45980310-46017994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45981314 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 332 (E332A)
Ref Sequence ENSEMBL: ENSMUSP00000037519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049038
AA Change: E332A

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: E332A

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 50 80 N/A INTRINSIC
low complexity region 92 104 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 210 220 N/A INTRINSIC
HMG 365 435 8.35e-24 SMART
low complexity region 523 539 N/A INTRINSIC
Blast:Pept_C1 572 734 1e-92 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnah5 A T 15: 28,453,353 E4423D possibly damaging Het
Fsip2 A T 2: 82,978,973 T1879S possibly damaging Het
Gm136 G T 4: 34,746,593 H139Q possibly damaging Het
Ifrd2 T A 9: 107,587,917 L10H probably damaging Het
Itpr3 C A 17: 27,095,992 H704Q probably benign Het
Kcng1 A G 2: 168,269,046 I66T probably damaging Het
Kcnv2 T C 19: 27,323,219 Y157H probably damaging Het
Leng8 A G 7: 4,143,808 D443G probably damaging Het
Mlst8 T C 17: 24,476,117 N264S possibly damaging Het
Pcdhb8 A G 18: 37,355,665 E132G probably benign Het
Pmpcb C G 5: 21,746,038 S266* probably null Het
Prmt7 T C 8: 106,237,350 I292T probably damaging Het
Rif1 T C 2: 52,110,092 L1186S possibly damaging Het
Taf2 T C 15: 55,038,338 D820G probably benign Het
Tas2r120 T A 6: 132,657,846 probably null Het
Zfp655 T C 5: 145,244,015 S228P probably damaging Het
Zfyve9 C A 4: 108,718,163 D574Y probably damaging Het
Other mutations in Sox30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Sox30 APN 11 45991900 missense possibly damaging 0.95
IGL01449:Sox30 APN 11 45981342 missense probably damaging 1.00
IGL02411:Sox30 APN 11 45981124 nonsense probably null
IGL02601:Sox30 APN 11 45984762 missense possibly damaging 0.81
IGL02747:Sox30 APN 11 45980945 missense probably benign 0.00
IGL03403:Sox30 APN 11 46017208 missense probably damaging 1.00
R1450:Sox30 UTSW 11 46017271 missense probably damaging 0.99
R2109:Sox30 UTSW 11 45991768 missense probably damaging 0.99
R2213:Sox30 UTSW 11 45984852 missense probably damaging 1.00
R3715:Sox30 UTSW 11 45984792 missense probably damaging 0.99
R4111:Sox30 UTSW 11 46017214 missense probably benign 0.09
R4723:Sox30 UTSW 11 45984765 missense probably benign 0.03
R5014:Sox30 UTSW 11 45991909 missense probably benign 0.01
R5408:Sox30 UTSW 11 45991867 missense possibly damaging 0.54
R5974:Sox30 UTSW 11 45981073 missense probably damaging 0.99
R6063:Sox30 UTSW 11 45991942 missense probably benign 0.04
R6948:Sox30 UTSW 11 46017339 missense probably damaging 1.00
R7242:Sox30 UTSW 11 45984520 intron probably null
R7258:Sox30 UTSW 11 45980552 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCGTCAAGGCCGAGAAGCAAG -3'
(R):5'- TGCAAGCTAAGGGCCGTACCAG -3'

Sequencing Primer
(F):5'- TGGTCCACAGCAGCAAG -3'
(R):5'- GGATTCTACTTTTCGAGCTTCAG -3'
Posted On2013-08-06