Mutagenetix > Incidental Mutations

Incidental Mutation 'R8313:Gnptab'

641513

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R8313 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88439209 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1090 (Y1090N)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020251
AA Change: Y1090N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: Y1090N

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atl2	C	T	17: 79,852,604	W518*	probably null	Het
Atp13a2	G	A	4: 141,002,735	V646I	probably benign	Het
Bcar1	A	T	8: 111,713,638	F575I	probably benign	Het
Bpifa6	T	A	2: 153,989,258	L248*	probably null	Het
Ccdc38	T	C	10: 93,563,249	L193P	probably damaging	Het
Ch25h	A	C	19: 34,474,738	I130S	probably benign	Het
Chaf1a	C	A	17: 56,044,109	Q30K	unknown	Het
Dab2ip	T	C	2: 35,727,428	L1106S	probably damaging	Het
Dnah3	A	G	7: 119,951,152	Y3315H	probably benign	Het
Dnah7b	G	A	1: 46,175,296	V1074I	possibly damaging	Het
Efemp1	A	G	11: 28,910,691	Q200R	probably benign	Het
Epx	C	T	11: 87,872,731	R221Q	possibly damaging	Het
Exosc7	T	C	9: 123,127,877	L109P	probably damaging	Het
Fam150b	G	T	12: 30,884,851	G23V	probably damaging	Het
Fbxo22	T	A	9: 55,221,060	F222I	probably damaging	Het
Fcgbp	A	G	7: 28,086,344	D402G	probably benign	Het
Foxr1	A	G	9: 44,436,054	V62A	probably damaging	Het
Gm2016	A	T	12: 87,876,994	D137V	unknown	Het
Gm8267	A	T	14: 44,724,058	H59Q	probably damaging	Het
Gpr20	A	G	15: 73,696,312	F76S	probably damaging	Het
Gpr33	A	G	12: 52,024,124	V44A	probably benign	Het
Grin3a	G	A	4: 49,665,599	T1012I	probably benign	Het
Itga1	T	A	13: 114,966,584	T1104S	probably benign	Het
Kidins220	T	A	12: 25,004,111	Y537N	probably damaging	Het
Lama1	A	G	17: 67,750,520	T530A		Het
Lysmd2	A	T	9: 75,625,758		probably benign	Het
Mdk	T	C	2: 91,930,833	K128E	unknown	Het
Mphosph8	AC	A	14: 56,678,605		probably null	Het
Muc16	A	C	9: 18,525,147	L7915W	possibly damaging	Het
Muc4	A	T	16: 32,753,423	T1100S	probably benign	Het
Mxra7	T	C	11: 116,804,550	Y176C	probably damaging	Het
Myh15	C	A	16: 49,120,018	T777N	probably damaging	Het
Myo18b	A	G	5: 112,875,179	S116P	unknown	Het
Noc3l	A	G	19: 38,795,810	L543P	probably damaging	Het
Olfr1355	C	T	10: 78,879,336	P55S	probably benign	Het
Olfr192	C	T	16: 59,098,641	G117D	unknown	Het
Olfr250	T	A	9: 38,368,050	V168E	probably damaging	Het
Pkm	G	T	9: 59,668,619	R106L	probably benign	Het
Prkab2	G	T	3: 97,663,595	V112F	probably benign	Het
Prkaca	A	T	8: 83,990,522	N172Y	probably damaging	Het
Prmt8	A	G	6: 127,689,850	V387A	probably benign	Het
Rad17	T	C	13: 100,624,566	T485A	probably benign	Het
Rita1	G	T	5: 120,609,651	T194K	possibly damaging	Het
Rogdi	C	A	16: 5,013,449		probably benign	Het
Senp5	T	C	16: 31,989,299	D379G	probably benign	Het
Slc4a4	A	G	5: 89,046,263	K201E	possibly damaging	Het
Slc9a4	C	T	1: 40,580,360		probably benign	Het
Tmem175	T	A	5: 108,643,209	S208R	probably benign	Het
Tmem237	A	T	1: 59,108,078	Y299N	probably damaging	Het
Tnrc6a	T	A	7: 123,170,713	N575K	possibly damaging	Het
Trak2	A	T	1: 58,921,147	C232*	probably null	Het
Ubr3	A	G	2: 69,945,134	H589R	probably damaging	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r208	G	C	13: 22,772,777	I183M	probably benign	Het
Vmn1r231	C	T	17: 20,890,027	V209I	probably benign	Het
Vmn1r80	T	C	7: 12,193,067	F35L	probably benign	Het
Vmn2r58	A	T	7: 41,872,528	I48N	probably benign	Het
Vstm2a	T	A	11: 16,281,898	V231E	probably damaging	Het
Zfp108	A	C	7: 24,260,662	Y226S	possibly damaging	Het
Zfp445	A	T	9: 122,853,630	N415K	possibly damaging	Het
Zfp938	T	G	10: 82,225,588	R399S	possibly damaging	Het
Zmym4	G	A	4: 126,910,969	H464Y	probably benign	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0288:Gnptab	UTSW	10	88433105	missense	probably benign	0.00
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
R7770:Gnptab	UTSW	10	88411920	missense	probably benign	0.41
R7791:Gnptab	UTSW	10	88440222	critical splice acceptor site	probably null
R7838:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
R8002:Gnptab	UTSW	10	88440268	missense	probably benign	0.14
R8168:Gnptab	UTSW	10	88419133	missense	probably benign	0.41
R8219:Gnptab	UTSW	10	88433792	missense	probably benign
R8221:Gnptab	UTSW	10	88440392	critical splice donor site	probably null
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99
Z1176:Gnptab	UTSW	10	88431368	missense	probably damaging	1.00
Z1177:Gnptab	UTSW	10	88440270	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATCCCAAGAGCGTGGCTAAG -3'
(R):5'- AGCATTCCTGGGTATTTATTGGAC -3'

Sequencing Primer
(F):5'- AGTATGTCTTTAGCTCAGTAGACCC -3'
(R):5'- CCTGGGTATTTATTGGACTCAACATG -3'

Posted On

2020-07-28