Incidental Mutation 'R8313:Epx'
ID641517
Institutional Source Beutler Lab
Gene Symbol Epx
Ensembl Gene ENSMUSG00000052234
Gene Nameeosinophil peroxidase
SynonymsEPO
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87864000-87875536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87872731 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 221 (R221Q)
Ref Sequence ENSEMBL: ENSMUSP00000050497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049768]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049768
AA Change: R221Q

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234
AA Change: R221Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peroxidase superfamily of enzymes that is produced by eosinophils and plays a critical role in eliminating tissue-invasive parasites. The encoded preproprotein undergoes proteolytic processing to generate a heterodimeric enzyme that forms a predominant component of the intracellular granules of eosinophils. Mice lacking the encoded protein exhibit resistance to ulcerative colitis induced by dextran sulfate. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted deletion of this gene results in ultrastructural changes of the eosinophil secondary granule but does not significantly alter the course of inflammation or development of allergic pulmonary pathologies in an ovalbumin-challenge model of pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Epx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Epx APN 11 87869925 missense probably damaging 1.00
IGL01723:Epx APN 11 87869402 missense probably damaging 1.00
IGL02096:Epx APN 11 87869468 missense probably damaging 1.00
IGL02423:Epx APN 11 87871318 missense possibly damaging 0.85
K7371:Epx UTSW 11 87864884 missense probably damaging 1.00
R1018:Epx UTSW 11 87869303 missense probably benign 0.05
R1607:Epx UTSW 11 87868712 missense probably damaging 1.00
R2017:Epx UTSW 11 87874337 missense probably damaging 1.00
R2030:Epx UTSW 11 87864824 missense probably damaging 1.00
R3838:Epx UTSW 11 87874830 missense probably damaging 1.00
R4417:Epx UTSW 11 87869430 nonsense probably null
R5083:Epx UTSW 11 87872680 missense probably damaging 0.99
R5712:Epx UTSW 11 87874853 nonsense probably null
R5935:Epx UTSW 11 87865492 missense probably damaging 1.00
R6830:Epx UTSW 11 87868626 missense probably damaging 1.00
R6857:Epx UTSW 11 87869955 nonsense probably null
R6984:Epx UTSW 11 87868598 missense probably damaging 1.00
R7031:Epx UTSW 11 87875523 start gained probably benign
R7652:Epx UTSW 11 87875334 critical splice donor site probably null
R7667:Epx UTSW 11 87874311 missense probably damaging 0.98
R7969:Epx UTSW 11 87872721 missense probably benign 0.01
X0065:Epx UTSW 11 87865475 missense probably benign 0.03
Z1177:Epx UTSW 11 87869261 missense probably damaging 1.00
Z1177:Epx UTSW 11 87869894 missense possibly damaging 0.56
Z1177:Epx UTSW 11 87872767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTGGGCTGGAAGCTACC -3'
(R):5'- TCTCTAACAACAGAAGAAGTGCCAG -3'

Sequencing Primer
(F):5'- CCCAGAAACCTAGAAGGCTGG -3'
(R):5'- TGCCAGGAGGAGAGGGTG -3'
Posted On2020-07-28