Mutagenetix > Incidental Mutations

Incidental Mutation 'R8313:Kidins220'

641519

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8313 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24974925-25063152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25004111 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 537 (Y537N)

Ref Sequence

ENSEMBL: ENSMUSP00000063999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066652
AA Change: Y537N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: Y537N

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220459
AA Change: Y495N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221050

Predicted Effect

unknown
Transcript: ENSMUST00000222013
AA Change: Y366N

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222941
AA Change: Y537N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atl2	C	T	17: 79,852,604	W518*	probably null	Het
Atp13a2	G	A	4: 141,002,735	V646I	probably benign	Het
Bcar1	A	T	8: 111,713,638	F575I	probably benign	Het
Bpifa6	T	A	2: 153,989,258	L248*	probably null	Het
Ccdc38	T	C	10: 93,563,249	L193P	probably damaging	Het
Ch25h	A	C	19: 34,474,738	I130S	probably benign	Het
Chaf1a	C	A	17: 56,044,109	Q30K	unknown	Het
Dab2ip	T	C	2: 35,727,428	L1106S	probably damaging	Het
Dnah3	A	G	7: 119,951,152	Y3315H	probably benign	Het
Dnah7b	G	A	1: 46,175,296	V1074I	possibly damaging	Het
Efemp1	A	G	11: 28,910,691	Q200R	probably benign	Het
Epx	C	T	11: 87,872,731	R221Q	possibly damaging	Het
Exosc7	T	C	9: 123,127,877	L109P	probably damaging	Het
Fam150b	G	T	12: 30,884,851	G23V	probably damaging	Het
Fbxo22	T	A	9: 55,221,060	F222I	probably damaging	Het
Fcgbp	A	G	7: 28,086,344	D402G	probably benign	Het
Foxr1	A	G	9: 44,436,054	V62A	probably damaging	Het
Gm2016	A	T	12: 87,876,994	D137V	unknown	Het
Gm8267	A	T	14: 44,724,058	H59Q	probably damaging	Het
Gnptab	T	A	10: 88,439,209	Y1090N	probably damaging	Het
Gpr20	A	G	15: 73,696,312	F76S	probably damaging	Het
Gpr33	A	G	12: 52,024,124	V44A	probably benign	Het
Grin3a	G	A	4: 49,665,599	T1012I	probably benign	Het
Itga1	T	A	13: 114,966,584	T1104S	probably benign	Het
Lama1	A	G	17: 67,750,520	T530A		Het
Lysmd2	A	T	9: 75,625,758		probably benign	Het
Mdk	T	C	2: 91,930,833	K128E	unknown	Het
Mphosph8	AC	A	14: 56,678,605		probably null	Het
Muc16	A	C	9: 18,525,147	L7915W	possibly damaging	Het
Muc4	A	T	16: 32,753,423	T1100S	probably benign	Het
Mxra7	T	C	11: 116,804,550	Y176C	probably damaging	Het
Myh15	C	A	16: 49,120,018	T777N	probably damaging	Het
Myo18b	A	G	5: 112,875,179	S116P	unknown	Het
Noc3l	A	G	19: 38,795,810	L543P	probably damaging	Het
Olfr1355	C	T	10: 78,879,336	P55S	probably benign	Het
Olfr192	C	T	16: 59,098,641	G117D	unknown	Het
Olfr250	T	A	9: 38,368,050	V168E	probably damaging	Het
Pkm	G	T	9: 59,668,619	R106L	probably benign	Het
Prkab2	G	T	3: 97,663,595	V112F	probably benign	Het
Prkaca	A	T	8: 83,990,522	N172Y	probably damaging	Het
Prmt8	A	G	6: 127,689,850	V387A	probably benign	Het
Rad17	T	C	13: 100,624,566	T485A	probably benign	Het
Rita1	G	T	5: 120,609,651	T194K	possibly damaging	Het
Rogdi	C	A	16: 5,013,449		probably benign	Het
Senp5	T	C	16: 31,989,299	D379G	probably benign	Het
Slc4a4	A	G	5: 89,046,263	K201E	possibly damaging	Het
Slc9a4	C	T	1: 40,580,360		probably benign	Het
Tmem175	T	A	5: 108,643,209	S208R	probably benign	Het
Tmem237	A	T	1: 59,108,078	Y299N	probably damaging	Het
Tnrc6a	T	A	7: 123,170,713	N575K	possibly damaging	Het
Trak2	A	T	1: 58,921,147	C232*	probably null	Het
Ubr3	A	G	2: 69,945,134	H589R	probably damaging	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r208	G	C	13: 22,772,777	I183M	probably benign	Het
Vmn1r231	C	T	17: 20,890,027	V209I	probably benign	Het
Vmn1r80	T	C	7: 12,193,067	F35L	probably benign	Het
Vmn2r58	A	T	7: 41,872,528	I48N	probably benign	Het
Vstm2a	T	A	11: 16,281,898	V231E	probably damaging	Het
Zfp108	A	C	7: 24,260,662	Y226S	possibly damaging	Het
Zfp445	A	T	9: 122,853,630	N415K	possibly damaging	Het
Zfp938	T	G	10: 82,225,588	R399S	possibly damaging	Het
Zmym4	G	A	4: 126,910,969	H464Y	probably benign	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25038560	splice site	probably benign
IGL00959:Kidins220	APN	12	25051133	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25057474	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25010926	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25038499	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25040460	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	24995000	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25057729	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25004111	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	24997333	splice site	probably benign
IGL02673:Kidins220	APN	12	24994992	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25003093	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25003045	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25008448	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	24999345	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25008156	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	24999352	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25040512	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25010141	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25008069	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25005088	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25013446	splice site	probably benign
R1808:Kidins220	UTSW	12	25003009	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25056591	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	24994906	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25051194	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	24987006	splice site	probably benign
R2101:Kidins220	UTSW	12	25057423	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25041303	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25057324	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25011509	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	24990758	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25001565	splice site	probably benign
R3915:Kidins220	UTSW	12	25053958	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25057144	splice site	probably null
R4287:Kidins220	UTSW	12	25056846	missense	possibly damaging	0.81
R4476:Kidins220	UTSW	12	25011001	missense	probably damaging	1.00
R4495:Kidins220	UTSW	12	25038302	splice site	probably null
R4627:Kidins220	UTSW	12	25057042	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25057285	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25013443	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	24992260	nonsense	probably null
R5118:Kidins220	UTSW	12	24992297	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25051126	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25003010	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25047897	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25013391	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25057140	nonsense	probably null
R6131:Kidins220	UTSW	12	24992314	splice site	probably null
R6146:Kidins220	UTSW	12	25052813	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25056909	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	24997311	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25051308	splice site	probably null
R6289:Kidins220	UTSW	12	25056616	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25057534	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25057191	missense	probably benign
R6513:Kidins220	UTSW	12	25038435	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25010060	splice site	probably null
R6711:Kidins220	UTSW	12	24998751	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25008543	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25057663	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25004019	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	24994821	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25036624	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25011571	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25057000	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	24982361	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	24992269	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	24988556	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	24982351	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25061231	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25057716	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	24994855	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25057128	missense	probably benign	0.01
R8346:Kidins220	UTSW	12	25036534	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	24990728	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25040528	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGATGAAATGAAGACGTTTGCAG -3'
(R):5'- AGGGATGTACACGGTTACTCTATAC -3'

Sequencing Primer
(F):5'- AGACGTTTGCAGGGCAGC -3'
(R):5'- GGTCCTGAGTTCAAATCCCAG -3'

Posted On

2020-07-28