Mutagenetix > Incidental Mutations

Incidental Mutation 'R8313:Rad17'

641524

Institutional Source

Beutler Lab

Gene Symbol

Rad17

Ensembl Gene

ENSMUSG00000021635

Gene Name

RAD17 checkpoint clamp loader component

Synonyms

MmRad24, 9430035O09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8313 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100617164-100651051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100624566 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 485 (T485A)

Ref Sequence

ENSEMBL: ENSMUSP00000022136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022136] [ENSMUST00000177848]

Predicted Effect

probably benign
Transcript: ENSMUST00000022136
AA Change: T485A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000022136
Gene: ENSMUSG00000021635
AA Change: T485A

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC
AAA	128	280	1.1e-4	SMART
low complexity region	342	355	N/A	INTRINSIC
low complexity region	552	567	N/A	INTRINSIC
low complexity region	619	635	N/A	INTRINSIC
low complexity region	669	687	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177848
AA Change: T485A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000136292
Gene: ENSMUSG00000021635
AA Change: T485A

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC
AAA	128	280	1.1e-4	SMART
low complexity region	342	355	N/A	INTRINSIC
low complexity region	552	567	N/A	INTRINSIC
low complexity region	619	635	N/A	INTRINSIC
low complexity region	669	687	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality with incomplete somite formation, abnormal bracnchial arch, liver, and heart morphology, abnormal neural tube development, and multiple hemorrhages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atl2	C	T	17: 79,852,604	W518*	probably null	Het
Atp13a2	G	A	4: 141,002,735	V646I	probably benign	Het
Bcar1	A	T	8: 111,713,638	F575I	probably benign	Het
Bpifa6	T	A	2: 153,989,258	L248*	probably null	Het
Ccdc38	T	C	10: 93,563,249	L193P	probably damaging	Het
Ch25h	A	C	19: 34,474,738	I130S	probably benign	Het
Chaf1a	C	A	17: 56,044,109	Q30K	unknown	Het
Dab2ip	T	C	2: 35,727,428	L1106S	probably damaging	Het
Dnah3	A	G	7: 119,951,152	Y3315H	probably benign	Het
Dnah7b	G	A	1: 46,175,296	V1074I	possibly damaging	Het
Efemp1	A	G	11: 28,910,691	Q200R	probably benign	Het
Epx	C	T	11: 87,872,731	R221Q	possibly damaging	Het
Exosc7	T	C	9: 123,127,877	L109P	probably damaging	Het
Fam150b	G	T	12: 30,884,851	G23V	probably damaging	Het
Fbxo22	T	A	9: 55,221,060	F222I	probably damaging	Het
Fcgbp	A	G	7: 28,086,344	D402G	probably benign	Het
Foxr1	A	G	9: 44,436,054	V62A	probably damaging	Het
Gm2016	A	T	12: 87,876,994	D137V	unknown	Het
Gm8267	A	T	14: 44,724,058	H59Q	probably damaging	Het
Gnptab	T	A	10: 88,439,209	Y1090N	probably damaging	Het
Gpr20	A	G	15: 73,696,312	F76S	probably damaging	Het
Gpr33	A	G	12: 52,024,124	V44A	probably benign	Het
Grin3a	G	A	4: 49,665,599	T1012I	probably benign	Het
Itga1	T	A	13: 114,966,584	T1104S	probably benign	Het
Kidins220	T	A	12: 25,004,111	Y537N	probably damaging	Het
Lama1	A	G	17: 67,750,520	T530A		Het
Lysmd2	A	T	9: 75,625,758		probably benign	Het
Mdk	T	C	2: 91,930,833	K128E	unknown	Het
Mphosph8	AC	A	14: 56,678,605		probably null	Het
Muc16	A	C	9: 18,525,147	L7915W	possibly damaging	Het
Muc4	A	T	16: 32,753,423	T1100S	probably benign	Het
Mxra7	T	C	11: 116,804,550	Y176C	probably damaging	Het
Myh15	C	A	16: 49,120,018	T777N	probably damaging	Het
Myo18b	A	G	5: 112,875,179	S116P	unknown	Het
Noc3l	A	G	19: 38,795,810	L543P	probably damaging	Het
Olfr1355	C	T	10: 78,879,336	P55S	probably benign	Het
Olfr192	C	T	16: 59,098,641	G117D	unknown	Het
Olfr250	T	A	9: 38,368,050	V168E	probably damaging	Het
Pkm	G	T	9: 59,668,619	R106L	probably benign	Het
Prkab2	G	T	3: 97,663,595	V112F	probably benign	Het
Prkaca	A	T	8: 83,990,522	N172Y	probably damaging	Het
Prmt8	A	G	6: 127,689,850	V387A	probably benign	Het
Rita1	G	T	5: 120,609,651	T194K	possibly damaging	Het
Rogdi	C	A	16: 5,013,449		probably benign	Het
Senp5	T	C	16: 31,989,299	D379G	probably benign	Het
Slc4a4	A	G	5: 89,046,263	K201E	possibly damaging	Het
Slc9a4	C	T	1: 40,580,360		probably benign	Het
Tmem175	T	A	5: 108,643,209	S208R	probably benign	Het
Tmem237	A	T	1: 59,108,078	Y299N	probably damaging	Het
Tnrc6a	T	A	7: 123,170,713	N575K	possibly damaging	Het
Trak2	A	T	1: 58,921,147	C232*	probably null	Het
Ubr3	A	G	2: 69,945,134	H589R	probably damaging	Het
Vcp	T	C	4: 42,988,728	T249A	possibly damaging	Het
Vmn1r208	G	C	13: 22,772,777	I183M	probably benign	Het
Vmn1r231	C	T	17: 20,890,027	V209I	probably benign	Het
Vmn1r80	T	C	7: 12,193,067	F35L	probably benign	Het
Vmn2r58	A	T	7: 41,872,528	I48N	probably benign	Het
Vstm2a	T	A	11: 16,281,898	V231E	probably damaging	Het
Zfp108	A	C	7: 24,260,662	Y226S	possibly damaging	Het
Zfp445	A	T	9: 122,853,630	N415K	possibly damaging	Het
Zfp938	T	G	10: 82,225,588	R399S	possibly damaging	Het
Zmym4	G	A	4: 126,910,969	H464Y	probably benign	Het

Other mutations in Rad17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Rad17	APN	13	100629525	missense	probably benign	0.03
IGL00422:Rad17	APN	13	100629523	missense	probably damaging	0.98
IGL00478:Rad17	APN	13	100633274	missense	probably damaging	1.00
IGL01328:Rad17	APN	13	100617803	missense	probably benign
IGL01720:Rad17	APN	13	100622858	missense	possibly damaging	0.51
IGL01874:Rad17	APN	13	100617684	utr 3 prime	probably benign
IGL02305:Rad17	APN	13	100633862	critical splice donor site	probably null
IGL02541:Rad17	APN	13	100633443	splice site	probably benign
R0678:Rad17	UTSW	13	100645184	missense	possibly damaging	0.73
R1079:Rad17	UTSW	13	100633899	missense	probably benign	0.01
R1422:Rad17	UTSW	13	100645082	missense	probably benign	0.18
R1730:Rad17	UTSW	13	100622806	missense	probably damaging	0.97
R3946:Rad17	UTSW	13	100622863	missense	possibly damaging	0.70
R4577:Rad17	UTSW	13	100633278	missense	probably damaging	1.00
R4735:Rad17	UTSW	13	100619129	missense	probably damaging	0.98
R5023:Rad17	UTSW	13	100645063	missense	possibly damaging	0.88
R5098:Rad17	UTSW	13	100617646	makesense	probably null
R5222:Rad17	UTSW	13	100633891	missense	possibly damaging	0.53
R5511:Rad17	UTSW	13	100627649	missense	possibly damaging	0.82
R5536:Rad17	UTSW	13	100631104	missense	probably damaging	1.00
R5887:Rad17	UTSW	13	100633861	critical splice donor site	probably null
R6041:Rad17	UTSW	13	100617766	missense	probably benign	0.01
R6173:Rad17	UTSW	13	100622881	missense	probably benign
R6342:Rad17	UTSW	13	100619136	missense	probably damaging	1.00
R6465:Rad17	UTSW	13	100637080	missense	probably benign	0.34
R6730:Rad17	UTSW	13	100649745	start gained	probably benign
R6890:Rad17	UTSW	13	100637084	missense	probably benign	0.34
R6947:Rad17	UTSW	13	100622875	missense	probably damaging	1.00
R7035:Rad17	UTSW	13	100627625	missense	possibly damaging	0.78
R7113:Rad17	UTSW	13	100629517	missense	probably benign	0.03
R7408:Rad17	UTSW	13	100629511	nonsense	probably null
R7553:Rad17	UTSW	13	100633286	missense	probably damaging	1.00
R7573:Rad17	UTSW	13	100629466	missense	probably damaging	0.99
R8346:Rad17	UTSW	13	100645173	missense	possibly damaging	0.77
RF022:Rad17	UTSW	13	100637085	missense	probably damaging	1.00
Z1176:Rad17	UTSW	13	100627632	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGCCTCCATATCATCGACCT -3'
(R):5'- GTGCATTTGATCCCTATGTCTCAG -3'

Sequencing Primer
(F):5'- TCATCGACCTCATAATCCATTCAATC -3'
(R):5'- GATCCCTATGTCTCAGCTGAG -3'

Posted On

2020-07-28