Incidental Mutation 'R8313:Myh15'
ID641532
Institutional Source Beutler Lab
Gene Symbol Myh15
Ensembl Gene ENSMUSG00000092009
Gene Namemyosin, heavy chain 15
SynonymsEG667772
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location49057486-49199104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49120018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 777 (T777N)
Ref Sequence ENSEMBL: ENSMUSP00000127539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168680]
Predicted Effect probably damaging
Transcript: ENSMUST00000168680
AA Change: T777N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127539
Gene: ENSMUSG00000092009
AA Change: T777N

DomainStartEndE-ValueType
Pfam:Myosin_N 30 70 5.2e-12 PFAM
MYSc 76 770 N/A SMART
Pfam:Myosin_tail_1 836 1915 9.5e-118 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atl2 C T 17: 79,852,604 W518* probably null Het
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Myh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Myh15 APN 16 49165813 missense probably damaging 0.98
IGL01095:Myh15 APN 16 49132015 missense probably damaging 1.00
IGL01343:Myh15 APN 16 49155677 missense probably benign 0.09
IGL01474:Myh15 APN 16 49132098 missense probably damaging 1.00
IGL01572:Myh15 APN 16 49100222 missense possibly damaging 0.55
IGL01595:Myh15 APN 16 49172949 missense probably damaging 1.00
IGL01632:Myh15 APN 16 49061511 missense probably benign 0.00
IGL01638:Myh15 APN 16 49069480 missense probably damaging 1.00
IGL01667:Myh15 APN 16 49195579 missense probably benign 0.20
IGL01715:Myh15 APN 16 49057484 unclassified probably benign
IGL01833:Myh15 APN 16 49114058 missense probably damaging 1.00
IGL02004:Myh15 APN 16 49110529 splice site probably benign
IGL02033:Myh15 APN 16 49145344 missense probably benign 0.05
IGL02148:Myh15 APN 16 49116315 missense probably damaging 1.00
IGL02225:Myh15 APN 16 49091163 missense probably benign 0.14
IGL02249:Myh15 APN 16 49110484 missense probably damaging 0.99
IGL02505:Myh15 APN 16 49117263 missense possibly damaging 0.90
IGL02622:Myh15 APN 16 49176954 missense probably benign 0.02
IGL02814:Myh15 APN 16 49145438 splice site probably benign
IGL02869:Myh15 APN 16 49145404 missense probably benign
IGL02879:Myh15 APN 16 49173059 missense possibly damaging 0.68
IGL02881:Myh15 APN 16 49117265 missense possibly damaging 0.51
IGL03077:Myh15 APN 16 49096538 missense probably benign 0.10
IGL03354:Myh15 APN 16 49172010 missense probably benign 0.01
IGL03411:Myh15 APN 16 49159967 missense possibly damaging 0.58
ANU74:Myh15 UTSW 16 49172932 missense possibly damaging 0.58
P0027:Myh15 UTSW 16 49081208 missense possibly damaging 0.77
PIT1430001:Myh15 UTSW 16 49196891 critical splice donor site probably null
R0017:Myh15 UTSW 16 49163060 missense probably damaging 0.97
R0038:Myh15 UTSW 16 49071141 splice site probably benign
R0149:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0361:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0373:Myh15 UTSW 16 49182959 missense possibly damaging 0.86
R0433:Myh15 UTSW 16 49145236 missense probably damaging 1.00
R0525:Myh15 UTSW 16 49132051 missense probably benign 0.03
R0586:Myh15 UTSW 16 49171887 splice site probably benign
R0601:Myh15 UTSW 16 49061581 missense probably damaging 1.00
R0717:Myh15 UTSW 16 49142993 missense probably benign 0.03
R0963:Myh15 UTSW 16 49132149 missense probably damaging 0.97
R1075:Myh15 UTSW 16 49120054 missense possibly damaging 0.63
R1143:Myh15 UTSW 16 49065086 missense probably benign 0.02
R1200:Myh15 UTSW 16 49096519 missense probably damaging 1.00
R1644:Myh15 UTSW 16 49132203 missense probably benign 0.12
R1646:Myh15 UTSW 16 49195568 missense probably damaging 1.00
R1720:Myh15 UTSW 16 49092782 missense probably damaging 1.00
R1768:Myh15 UTSW 16 49163135 missense probably benign 0.27
R1881:Myh15 UTSW 16 49071083 missense probably damaging 0.98
R2048:Myh15 UTSW 16 49155565 missense probably damaging 0.99
R2064:Myh15 UTSW 16 49155621 missense possibly damaging 0.50
R2184:Myh15 UTSW 16 49137511 missense probably damaging 0.99
R2212:Myh15 UTSW 16 49138732 missense probably benign 0.02
R2216:Myh15 UTSW 16 49165838 nonsense probably null
R2321:Myh15 UTSW 16 49113073 missense possibly damaging 0.93
R2327:Myh15 UTSW 16 49142950 missense probably benign 0.01
R2395:Myh15 UTSW 16 49069514 missense probably benign 0.04
R2399:Myh15 UTSW 16 49137589 missense probably damaging 0.97
R3413:Myh15 UTSW 16 49138732 missense probably benign 0.02
R4234:Myh15 UTSW 16 49163042 missense probably benign 0.04
R4382:Myh15 UTSW 16 49142943 missense probably benign 0.03
R4421:Myh15 UTSW 16 49109344 missense probably damaging 0.99
R4580:Myh15 UTSW 16 49065025 missense possibly damaging 0.93
R4657:Myh15 UTSW 16 49172058 nonsense probably null
R4780:Myh15 UTSW 16 49120057 missense probably benign 0.13
R5004:Myh15 UTSW 16 49132048 missense probably damaging 0.99
R5175:Myh15 UTSW 16 49069426 missense possibly damaging 0.85
R5189:Myh15 UTSW 16 49101507 missense probably benign 0.20
R5311:Myh15 UTSW 16 49165841 missense possibly damaging 0.94
R5318:Myh15 UTSW 16 49110471 missense probably damaging 0.99
R5404:Myh15 UTSW 16 49159978 missense probably benign 0.15
R5415:Myh15 UTSW 16 49117295 missense probably null 1.00
R5558:Myh15 UTSW 16 49069537 missense probably benign 0.32
R5977:Myh15 UTSW 16 49153503 missense probably damaging 1.00
R6004:Myh15 UTSW 16 49159699 missense probably benign 0.00
R6275:Myh15 UTSW 16 49145247 missense probably benign 0.00
R6381:Myh15 UTSW 16 49101481 missense probably damaging 1.00
R6448:Myh15 UTSW 16 49171932 missense probably damaging 0.99
R6516:Myh15 UTSW 16 49137633 missense probably benign 0.19
R6752:Myh15 UTSW 16 49182927 missense probably damaging 1.00
R6847:Myh15 UTSW 16 49145088 missense possibly damaging 0.70
R6868:Myh15 UTSW 16 49069403 missense probably damaging 1.00
R6889:Myh15 UTSW 16 49153111 missense possibly damaging 0.75
R6896:Myh15 UTSW 16 49113071 missense probably benign 0.44
R6955:Myh15 UTSW 16 49081235 critical splice donor site probably null
R6984:Myh15 UTSW 16 49110412 missense probably damaging 1.00
R7046:Myh15 UTSW 16 49109299 nonsense probably null
R7095:Myh15 UTSW 16 49171909 missense possibly damaging 0.90
R7098:Myh15 UTSW 16 49177057 missense possibly damaging 0.53
R7134:Myh15 UTSW 16 49081342 missense possibly damaging 0.86
R7159:Myh15 UTSW 16 49061574 missense probably damaging 0.97
R7244:Myh15 UTSW 16 49196786 missense probably damaging 1.00
R7278:Myh15 UTSW 16 49091105 missense probably damaging 0.98
R7309:Myh15 UTSW 16 49096465 missense probably benign 0.34
R7327:Myh15 UTSW 16 49173006 missense possibly damaging 0.88
R7418:Myh15 UTSW 16 49155537 missense possibly damaging 0.69
R7937:Myh15 UTSW 16 49155646 missense probably benign 0.00
R8053:Myh15 UTSW 16 49142939 missense possibly damaging 0.89
R8315:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8316:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8317:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8342:Myh15 UTSW 16 49092757 missense probably benign
R8379:Myh15 UTSW 16 49081188 missense probably benign
R8445:Myh15 UTSW 16 49120018 missense probably damaging 0.99
X0012:Myh15 UTSW 16 49142978 missense probably damaging 1.00
X0020:Myh15 UTSW 16 49165874 missense probably damaging 1.00
Z1176:Myh15 UTSW 16 49096531 missense probably damaging 0.98
Z1177:Myh15 UTSW 16 49081228 missense probably benign 0.02
Z1177:Myh15 UTSW 16 49155618 missense probably damaging 0.97
Z1177:Myh15 UTSW 16 49159826 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGATTGGTACATAGCTCTCCC -3'
(R):5'- AGACAGAAAGGTCCTTTATACTGTC -3'

Sequencing Primer
(F):5'- CAGAGACTATGCCAGTTGTCCATG -3'
(R):5'- GGAGATTTTCAACACTCAGACTCAG -3'
Posted On2020-07-28