Incidental Mutation 'R8313:Vmn1r231'
ID 641534
Institutional Source Beutler Lab
Gene Symbol Vmn1r231
Ensembl Gene ENSMUSG00000050933
Gene Name vomeronasal 1 receptor 231
Synonyms V1re7
MMRRC Submission 067797-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R8313 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 21109978-21110913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21110289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 209 (V209I)
Ref Sequence ENSEMBL: ENSMUSP00000056228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061278]
AlphaFold Q8R2A3
Predicted Effect probably benign
Transcript: ENSMUST00000061278
AA Change: V209I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000056228
Gene: ENSMUSG00000050933
AA Change: V209I

DomainStartEndE-ValueType
Pfam:TAS2R 6 294 1.6e-13 PFAM
Pfam:V1R 36 297 1.6e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal2 G T 12: 30,934,850 (GRCm39) G23V probably damaging Het
Atl2 C T 17: 80,160,033 (GRCm39) W518* probably null Het
Atp13a2 G A 4: 140,730,046 (GRCm39) V646I probably benign Het
Bcar1 A T 8: 112,440,270 (GRCm39) F575I probably benign Het
Bpifa6 T A 2: 153,831,178 (GRCm39) L248* probably null Het
Ccdc38 T C 10: 93,399,111 (GRCm39) L193P probably damaging Het
Ch25h A C 19: 34,452,138 (GRCm39) I130S probably benign Het
Chaf1a C A 17: 56,351,109 (GRCm39) Q30K unknown Het
Dab2ip T C 2: 35,617,440 (GRCm39) L1106S probably damaging Het
Dnah3 A G 7: 119,550,375 (GRCm39) Y3315H probably benign Het
Dnah7b G A 1: 46,214,456 (GRCm39) V1074I possibly damaging Het
Efemp1 A G 11: 28,860,691 (GRCm39) Q200R probably benign Het
Eif1ad3 A T 12: 87,843,764 (GRCm39) D137V unknown Het
Epx C T 11: 87,763,557 (GRCm39) R221Q possibly damaging Het
Exosc7 T C 9: 122,956,942 (GRCm39) L109P probably damaging Het
Fbxo22 T A 9: 55,128,344 (GRCm39) F222I probably damaging Het
Fcgbp A G 7: 27,785,769 (GRCm39) D402G probably benign Het
Foxr1 A G 9: 44,347,351 (GRCm39) V62A probably damaging Het
Gm8267 A T 14: 44,961,515 (GRCm39) H59Q probably damaging Het
Gnptab T A 10: 88,275,071 (GRCm39) Y1090N probably damaging Het
Gpr20 A G 15: 73,568,161 (GRCm39) F76S probably damaging Het
Gpr33 A G 12: 52,070,907 (GRCm39) V44A probably benign Het
Grin3a G A 4: 49,665,599 (GRCm39) T1012I probably benign Het
Itga1 T A 13: 115,103,120 (GRCm39) T1104S probably benign Het
Kidins220 T A 12: 25,054,110 (GRCm39) Y537N probably damaging Het
Lama1 A G 17: 68,057,515 (GRCm39) T530A Het
Lysmd2 A T 9: 75,533,040 (GRCm39) probably benign Het
Mdk T C 2: 91,761,178 (GRCm39) K128E unknown Het
Mphosph8 AC A 14: 56,916,062 (GRCm39) probably null Het
Muc16 A C 9: 18,436,443 (GRCm39) L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 (GRCm38) T1100S probably benign Het
Mxra7 T C 11: 116,695,376 (GRCm39) Y176C probably damaging Het
Myh15 C A 16: 48,940,381 (GRCm39) T777N probably damaging Het
Myo18b A G 5: 113,023,045 (GRCm39) S116P unknown Het
Noc3l A G 19: 38,784,254 (GRCm39) L543P probably damaging Het
Or5h24 C T 16: 58,919,004 (GRCm39) G117D unknown Het
Or7a39 C T 10: 78,715,170 (GRCm39) P55S probably benign Het
Or8c10 T A 9: 38,279,346 (GRCm39) V168E probably damaging Het
Pkm G T 9: 59,575,902 (GRCm39) R106L probably benign Het
Prkab2 G T 3: 97,570,911 (GRCm39) V112F probably benign Het
Prkaca A T 8: 84,717,151 (GRCm39) N172Y probably damaging Het
Prmt8 A G 6: 127,666,813 (GRCm39) V387A probably benign Het
Rad17 T C 13: 100,761,074 (GRCm39) T485A probably benign Het
Rita1 G T 5: 120,747,716 (GRCm39) T194K possibly damaging Het
Rogdi C A 16: 4,831,313 (GRCm39) probably benign Het
Senp5 T C 16: 31,808,117 (GRCm39) D379G probably benign Het
Slc4a4 A G 5: 89,194,122 (GRCm39) K201E possibly damaging Het
Slc9a4 C T 1: 40,619,520 (GRCm39) probably benign Het
Tmem175 T A 5: 108,791,075 (GRCm39) S208R probably benign Het
Tmem237 A T 1: 59,147,237 (GRCm39) Y299N probably damaging Het
Tnrc6a T A 7: 122,769,936 (GRCm39) N575K possibly damaging Het
Trak2 A T 1: 58,960,306 (GRCm39) C232* probably null Het
Ubr3 A G 2: 69,775,478 (GRCm39) H589R probably damaging Het
Vcp T C 4: 42,988,728 (GRCm39) T249A possibly damaging Het
Vmn1r208 G C 13: 22,956,947 (GRCm39) I183M probably benign Het
Vmn1r80 T C 7: 11,926,994 (GRCm39) F35L probably benign Het
Vmn2r58 A T 7: 41,521,952 (GRCm39) I48N probably benign Het
Vstm2a T A 11: 16,231,898 (GRCm39) V231E probably damaging Het
Zfp108 A C 7: 23,960,087 (GRCm39) Y226S possibly damaging Het
Zfp445 A T 9: 122,682,695 (GRCm39) N415K possibly damaging Het
Zfp938 T G 10: 82,061,422 (GRCm39) R399S possibly damaging Het
Zmym4 G A 4: 126,804,762 (GRCm39) H464Y probably benign Het
Other mutations in Vmn1r231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r231 APN 17 21,110,828 (GRCm39) missense possibly damaging 0.68
IGL02124:Vmn1r231 APN 17 21,110,568 (GRCm39) missense probably damaging 1.00
IGL02151:Vmn1r231 APN 17 21,109,997 (GRCm39) missense probably benign 0.06
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0066:Vmn1r231 UTSW 17 21,109,998 (GRCm39) missense probably benign 0.27
R0396:Vmn1r231 UTSW 17 21,110,661 (GRCm39) missense probably damaging 0.98
R0427:Vmn1r231 UTSW 17 21,110,490 (GRCm39) missense probably benign 0.05
R0470:Vmn1r231 UTSW 17 21,110,265 (GRCm39) nonsense probably null
R0848:Vmn1r231 UTSW 17 21,110,433 (GRCm39) missense probably damaging 1.00
R1692:Vmn1r231 UTSW 17 21,110,871 (GRCm39) missense probably benign 0.02
R1987:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R1988:Vmn1r231 UTSW 17 21,110,212 (GRCm39) missense probably damaging 1.00
R2105:Vmn1r231 UTSW 17 21,110,380 (GRCm39) missense possibly damaging 0.66
R4440:Vmn1r231 UTSW 17 21,110,718 (GRCm39) missense possibly damaging 0.48
R4634:Vmn1r231 UTSW 17 21,110,660 (GRCm39) missense possibly damaging 0.46
R4646:Vmn1r231 UTSW 17 21,110,571 (GRCm39) missense probably damaging 1.00
R4678:Vmn1r231 UTSW 17 21,110,489 (GRCm39) missense possibly damaging 0.94
R4696:Vmn1r231 UTSW 17 21,110,901 (GRCm39) missense possibly damaging 0.63
R4938:Vmn1r231 UTSW 17 21,110,613 (GRCm39) missense possibly damaging 0.76
R5544:Vmn1r231 UTSW 17 21,110,840 (GRCm39) missense probably damaging 1.00
R5942:Vmn1r231 UTSW 17 21,110,417 (GRCm39) missense possibly damaging 0.83
R6053:Vmn1r231 UTSW 17 21,110,081 (GRCm39) missense probably damaging 1.00
R6692:Vmn1r231 UTSW 17 21,110,745 (GRCm39) missense possibly damaging 0.46
R6712:Vmn1r231 UTSW 17 21,109,992 (GRCm39) missense possibly damaging 0.54
R7131:Vmn1r231 UTSW 17 21,110,140 (GRCm39) missense possibly damaging 0.87
R7854:Vmn1r231 UTSW 17 21,110,894 (GRCm39) missense probably damaging 0.98
R7918:Vmn1r231 UTSW 17 21,110,236 (GRCm39) nonsense probably null
R8187:Vmn1r231 UTSW 17 21,110,893 (GRCm39) missense probably benign 0.10
R8238:Vmn1r231 UTSW 17 21,110,640 (GRCm39) missense probably benign 0.08
R8525:Vmn1r231 UTSW 17 21,110,001 (GRCm39) missense probably benign 0.06
R9276:Vmn1r231 UTSW 17 21,110,560 (GRCm39) missense probably benign 0.00
RF010:Vmn1r231 UTSW 17 21,110,255 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTAATCATCCACCAGCCAGC -3'
(R):5'- TCACCATCAGTCCCAGTGAC -3'

Sequencing Primer
(F):5'- AGTGACACTAGCACCAGA -3'
(R):5'- CCAGTGACTCGTGCCTTAATGG -3'
Posted On 2020-07-28