Incidental Mutation 'R8313:Atl2'
ID641537
Institutional Source Beutler Lab
Gene Symbol Atl2
Ensembl Gene ENSMUSG00000059811
Gene Nameatlastin GTPase 2
Synonyms2010110I21Rik, Aip-2, Arl6ip2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8313 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location79848390-79896123 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 79852604 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 518 (W518*)
Ref Sequence ENSEMBL: ENSMUSP00000064758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068282] [ENSMUST00000112437]
Predicted Effect probably null
Transcript: ENSMUST00000068282
AA Change: W518*
SMART Domains Protein: ENSMUSP00000064758
Gene: ENSMUSG00000059811
AA Change: W518*

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Pfam:GBP 70 341 3.9e-105 PFAM
low complexity region 377 390 N/A INTRINSIC
Blast:HAMP 495 545 4e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000112437
AA Change: W347*
SMART Domains Protein: ENSMUSP00000108056
Gene: ENSMUSG00000059811
AA Change: W347*

DomainStartEndE-ValueType
Pfam:GBP 1 170 6.6e-69 PFAM
Pfam:GBP_C 172 302 2.7e-8 PFAM
Blast:HAMP 324 374 3e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a2 G A 4: 141,002,735 V646I probably benign Het
Bcar1 A T 8: 111,713,638 F575I probably benign Het
Bpifa6 T A 2: 153,989,258 L248* probably null Het
Ccdc38 T C 10: 93,563,249 L193P probably damaging Het
Ch25h A C 19: 34,474,738 I130S probably benign Het
Chaf1a C A 17: 56,044,109 Q30K unknown Het
Dab2ip T C 2: 35,727,428 L1106S probably damaging Het
Dnah3 A G 7: 119,951,152 Y3315H probably benign Het
Dnah7b G A 1: 46,175,296 V1074I possibly damaging Het
Efemp1 A G 11: 28,910,691 Q200R probably benign Het
Epx C T 11: 87,872,731 R221Q possibly damaging Het
Exosc7 T C 9: 123,127,877 L109P probably damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fbxo22 T A 9: 55,221,060 F222I probably damaging Het
Fcgbp A G 7: 28,086,344 D402G probably benign Het
Foxr1 A G 9: 44,436,054 V62A probably damaging Het
Gm2016 A T 12: 87,876,994 D137V unknown Het
Gm8267 A T 14: 44,724,058 H59Q probably damaging Het
Gnptab T A 10: 88,439,209 Y1090N probably damaging Het
Gpr20 A G 15: 73,696,312 F76S probably damaging Het
Gpr33 A G 12: 52,024,124 V44A probably benign Het
Grin3a G A 4: 49,665,599 T1012I probably benign Het
Itga1 T A 13: 114,966,584 T1104S probably benign Het
Kidins220 T A 12: 25,004,111 Y537N probably damaging Het
Lama1 A G 17: 67,750,520 T530A Het
Lysmd2 A T 9: 75,625,758 probably benign Het
Mdk T C 2: 91,930,833 K128E unknown Het
Mphosph8 AC A 14: 56,678,605 probably null Het
Muc16 A C 9: 18,525,147 L7915W possibly damaging Het
Muc4 A T 16: 32,753,423 T1100S probably benign Het
Mxra7 T C 11: 116,804,550 Y176C probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Myo18b A G 5: 112,875,179 S116P unknown Het
Noc3l A G 19: 38,795,810 L543P probably damaging Het
Olfr1355 C T 10: 78,879,336 P55S probably benign Het
Olfr192 C T 16: 59,098,641 G117D unknown Het
Olfr250 T A 9: 38,368,050 V168E probably damaging Het
Pkm G T 9: 59,668,619 R106L probably benign Het
Prkab2 G T 3: 97,663,595 V112F probably benign Het
Prkaca A T 8: 83,990,522 N172Y probably damaging Het
Prmt8 A G 6: 127,689,850 V387A probably benign Het
Rad17 T C 13: 100,624,566 T485A probably benign Het
Rita1 G T 5: 120,609,651 T194K possibly damaging Het
Rogdi C A 16: 5,013,449 probably benign Het
Senp5 T C 16: 31,989,299 D379G probably benign Het
Slc4a4 A G 5: 89,046,263 K201E possibly damaging Het
Slc9a4 C T 1: 40,580,360 probably benign Het
Tmem175 T A 5: 108,643,209 S208R probably benign Het
Tmem237 A T 1: 59,108,078 Y299N probably damaging Het
Tnrc6a T A 7: 123,170,713 N575K possibly damaging Het
Trak2 A T 1: 58,921,147 C232* probably null Het
Ubr3 A G 2: 69,945,134 H589R probably damaging Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn1r231 C T 17: 20,890,027 V209I probably benign Het
Vmn1r80 T C 7: 12,193,067 F35L probably benign Het
Vmn2r58 A T 7: 41,872,528 I48N probably benign Het
Vstm2a T A 11: 16,281,898 V231E probably damaging Het
Zfp108 A C 7: 24,260,662 Y226S possibly damaging Het
Zfp445 A T 9: 122,853,630 N415K possibly damaging Het
Zfp938 T G 10: 82,225,588 R399S possibly damaging Het
Zmym4 G A 4: 126,910,969 H464Y probably benign Het
Other mutations in Atl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Atl2 APN 17 79859785 critical splice donor site probably null
IGL02692:Atl2 APN 17 79865053 missense probably benign
IGL03127:Atl2 APN 17 79852854 missense probably damaging 0.99
IGL03377:Atl2 APN 17 79865090 missense probably damaging 1.00
R0164:Atl2 UTSW 17 79853831 unclassified probably benign
R1203:Atl2 UTSW 17 79852905 missense probably damaging 0.99
R1489:Atl2 UTSW 17 79852706 missense probably benign 0.00
R1663:Atl2 UTSW 17 79864711 missense probably damaging 1.00
R1977:Atl2 UTSW 17 79852590 missense probably damaging 1.00
R2032:Atl2 UTSW 17 79895944 missense probably benign
R4063:Atl2 UTSW 17 79850159 makesense probably null
R5104:Atl2 UTSW 17 79852617 missense probably benign 0.01
R5201:Atl2 UTSW 17 79865151 missense probably benign
R5362:Atl2 UTSW 17 79861461 missense probably damaging 1.00
R5387:Atl2 UTSW 17 79852800 missense probably benign 0.03
R6128:Atl2 UTSW 17 79865041 critical splice donor site probably null
R6369:Atl2 UTSW 17 79854555 missense probably damaging 0.96
R6416:Atl2 UTSW 17 79850223 missense probably benign 0.00
R6597:Atl2 UTSW 17 79852766 missense possibly damaging 0.68
R6885:Atl2 UTSW 17 79852553 missense probably damaging 1.00
R7428:Atl2 UTSW 17 79875798 splice site probably null
R7587:Atl2 UTSW 17 79865067 missense probably benign 0.25
R7646:Atl2 UTSW 17 79854607 missense probably damaging 1.00
R7781:Atl2 UTSW 17 79859831 missense probably damaging 1.00
R7949:Atl2 UTSW 17 79859860 missense probably damaging 1.00
R8170:Atl2 UTSW 17 79856261 missense possibly damaging 0.95
X0052:Atl2 UTSW 17 79852617 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTCACCGTCTGGCATAATC -3'
(R):5'- ATTCTGCCGCCGTTATCAGG -3'

Sequencing Primer
(F):5'- GGCATAATCACCAGGCTTTTAAG -3'
(R):5'- CCGTTATCAGGACCAGCTTGAAG -3'
Posted On2020-07-28